SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16215
Pre Gene Modal
BGIBMGA013977
Annotation
PREDICTED:_piggyBac_transposable_element-derived_protein_3-like_[Diuraphis_noxia]
Location in the cell
Nuclear   Reliability : 3.56
 

Sequence

CDS
ATGACGGCGTTCTTTGACAATGGTAGCGGAGTGCTGAGACCGTTGGACAGCGATTTAATATTACATCTGCTTCAAGACGGAAACGATTCTGAAGTAGAAGGTATCGATGATGATGACGAATTGCCTCTCCAAAGGCCTTGTAACCCTGCTGTCATTGATGTTCCATCACCACAATTTCCAATACCGCCCCCAGCTCAACCTCAACGTAGAAATGTGGTTCAAAACAAAGCAAAAGCCAGAAGAAGACTTTGGAGACAGGAGGCTTTTAGTCAAAAAGAACATGGCTACCCACAACGCGTTCAGCCGGGTGTTATCAGAGAACCCTTAGAATATTTTAGCGACTATTTTAATGATGATTTTTTTGAGTCAACTGCGTTTTGTACCAACAATTATTTCATGCGCCACAATGGCCGTATCTTAAACACAAATGCCATTGAATTAAAGAAACTGGTAGGCATACATTTCATCATGGGATGTATCCCATACCCGCGGTTGTTCATGTACTGGCGAGAAGGATTACGATTGGATATAGTCACGAACGTCATGGCCAGAGACAGGTTCAAGACTCTGCGTTCAGCATTGCACGTCGTTGACAGTGACACTGCTCCGACAGGAAATACCAACACACTGTGGAAAGTACAACCAATACTTGACCGGGTTAAAAAAACATGTGATCGACTCGAAAGACAGCCGGGATATTTTTCCATAGATGAACAAATGATCCCTTTTAGTGGTGTATGTCCACGTGGGCTGCGACAGGTTATCAAAACCAAGCCTCGACCCCAAGGTTTAAAAGTTTTTGTGGCCACCACACATGATGGACTAATGATTGACTTTGAAGTTTATAGAGGTGCCAGCACTTCAATGGGTGACAGATCTTTGGGAGTTGGAGCGTCGATAATTTTACATCTTTCTAAGTCAATTCCAAGAGGCAGCTGCATTTATTTTGACCGGTACTTCTCGTCAATACCTTTGCTTGAAAAGCTAAGCACTATTGGGCTACACGGTACAGCAACGCTAATGATGAATCGAATACCTGAACGGAAAAACATCGATTTCAAACCTGATCGCCGTATGAAACGTGGTGAATCGCAACAGTTCGTGTGTGACGATGTCGTAGTTGTTAAATGGATGGATAACAAATCCGTGCTAGTTGCATCAAACTGCACATCTGCTGACGATACAACATTTGTACAGCGTTGGAATAAAAATATCTCTGCTTTCACTGATGTTACCGCGCCCAAAATAATCGCTAATTACAATAGGTACATGGGTGGTGTGGACATCCTTGATCAATCAATGGAGTACTACCGCACCTTTATGAAGACGAGAAAATGGACGTTAAAGGTCATACTCCATTTCTTTGATCTGGCTCTTTGTAATGCATGGCGCTTGTATAAATTGGAATGTGCAGCAGCTGCGATCCCAAATAGCAAAGTTATGGACTTGTTAGAGTTTCGGATGCAAGTAGCAGATGGGCTTACCAACACGCCTAATCGCCGAAGGAGGATTAGCGAGAGTGATGAAAATGCTGTCGAAAATGTAGTGCAAAATAATAATACAAGGTTTAAGAGAACAAATCAGCCCTCTCAAGCCAAAAAGTACGACGGCTACGACCACCTTCCATGTTTTGAAAGCATTGATAATCCTCGCGCATGCAGAATGGAAAATTGTAAAAGCAGGTCAAAGATTCGCTCTGCGAATGCCAAGAAGTGGGAGGTAGAGCTGGCCACGTTGAAGAGTAACAATCTTCGACTGACGGCCGCCCTGCAGGAGAGCACCGCCAACGTGGATGAATGGAAGCGTCAGCTGCACCAGTACAGGGAGGAGGTCGCCAGGGCGCGCCACTATGCTGGAAAAGCAGGGGACGCGAACGAGGTTGAACAGCTGAGGCAGCGCGTGGCCCAGCTTGAAGCGGAGCTCGCCCAGAAGAACGAAGAGCTCGCTCAGATCACCAAGTCCAAGAAAATCGAGCAGGACGCGGAGGCCAAGTTAGCGCAGAGCCAGCTGGAGCTAGCCATAGCGGCCCAGGAGGGGCAGCGGCAGGTCGTGCAGGCCCTCGCCGACCAGCTCGCCCGCCAGCTCGAGGACCTGGCAACGATTCATCGAGAGCTGAACACGGCTCTGCAAACATGA
Protein
MTAFFDNGSGVLRPLDSDLILHLLQDGNDSEVEGIDDDDELPLQRPCNPAVIDVPSPQFPIPPPAQPQRRNVVQNKAKARRRLWRQEAFSQKEHGYPQRVQPGVIREPLEYFSDYFNDDFFESTAFCTNNYFMRHNGRILNTNAIELKKLVGIHFIMGCIPYPRLFMYWREGLRLDIVTNVMARDRFKTLRSALHVVDSDTAPTGNTNTLWKVQPILDRVKKTCDRLERQPGYFSIDEQMIPFSGVCPRGLRQVIKTKPRPQGLKVFVATTHDGLMIDFEVYRGASTSMGDRSLGVGASIILHLSKSIPRGSCIYFDRYFSSIPLLEKLSTIGLHGTATLMMNRIPERKNIDFKPDRRMKRGESQQFVCDDVVVVKWMDNKSVLVASNCTSADDTTFVQRWNKNISAFTDVTAPKIIANYNRYMGGVDILDQSMEYYRTFMKTRKWTLKVILHFFDLALCNAWRLYKLECAAAAIPNSKVMDLLEFRMQVADGLTNTPNRRRRISESDENAVENVVQNNNTRFKRTNQPSQAKKYDGYDHLPCFESIDNPRACRMENCKSRSKIRSANAKKWEVELATLKSNNLRLTAALQESTANVDEWKRQLHQYREEVARARHYAGKAGDANEVEQLRQRVAQLEAELAQKNEELAQITKSKKIEQDAEAKLAQSQLELAIAAQEGQRQVVQALADQLARQLEDLATIHRELNTALQT

Summary

Pfam
PF13843   DDE_Tnp_1_7
Interpro
IPR029526   PGBD       
PDB
6FSA     E-value=0.0587615,     Score=87

Ontologies

GO

Topology

Length:
711
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.28177
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01396
outside
1  -  711
 
 

Population Genetic Test Statistics

Pi
250.589886
Theta
176.969401
Tajima's D
0.989946
CLR
151.416281
CSRT
0.658617069146543
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号