SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16206
Pre Gene Modal
BGIBMGA009519
Annotation
Yokozuna_[Bombyx_mori]
Full name
Retrovirus-related Pol polyprotein from transposon TNT 1-94      
Location in the cell
Nuclear   Reliability : 3.641
 

Sequence

CDS
ATGTGCTATGATGATGAAAGCAACTTACAGCAATTTTTCCTAAAATTTGAAGGAATTCTTAGCGAATTAGCGGCAATCAACGTAAGCGTCGAAGTAGAAGACCAAATTTGCTATCTGCTGTCTTCTTTACCAAAGATATACGATCAATTAATTACATCAATTGAGACTATGGGTTCCGAGAAACAACTGAACATAGAATTTGTTAAAGCAAGACTACTCGATATGGAGACAAAGTTAAAAATGGACAGAAATAGTGAAGGTTATGAGAATAATGCCTTCATCACGTGCCACTCCTGCGGAAAACGTGGACACAAATCATTCGAATGCCGATCAGGACGAGGACAAGCGCCGAGTAGAGGACAGTCATTGACACGAGGACGGAGCTATCCAAGATCGTGTGGACGCTCATTTAGAGGAAATTCAAGTTCACGACATACAACGTATCAACATGCTTCAGCAGCAGGCACAGAAAATAAAGAAATAGGTTTCATTGCTAGCGATATTATTGCTAATGTGGGTGAATGTGGTAACATAGAACTAATTATAGACTCAGGATGTACGGAGCATTTAATAAATGAAAAATATGAAAATTATATGACGGATATTACGTATTTAGATAAACATGTCAAAATATTCGTAGCTAACGGCCAATGTATTACAACTAGTAAAAGAGGTAAACTTAAAGTAAAATATCAAAATACTACGATTAATATTGATGCTCTAATTGTGAAAGATGTTTCATACAATTTATTATCAGTAAAAAAGATTGTCGAGGCAGGTTTTAACATAAACTTTAATAAATACAATGTTAAAATATTTAATAAAAAGACATTTTTACGCGGCATCGTGCAAGGAAAGTTGTATAAGCTACAAGCCGAATTATGTAAGTCCGAAGTCTGTAATATTACTGATGCGACAGATCTATGGCACAAACGTTTAGGTCACTTAAATAGGAAAAGCCTTAATATACTAAACTTACCTGTATCTAATAGAATTTGCAGTCCTTGTATGGAGGGCAAAGCCACCCGAAGCCCGTTCACGCCTATCCCAAAGCCTAGAACAAAAATGACAGCCGAGATGCTTCACACAGACATAGCAGGACCGATCAGACATCAAGGACCTAATGGTGAAAAATATTTTATGAAAATTATTGACGATTTCTCTCATTTTTGCGTAGTGTATCCCCTGAAGAGCAAATCTGAAGCAACAGAACGACTGATGAACTATGTATTAAGAATTGAAAACGAAACGGGGAATAAAGTTAAAAGAATTAGATGCGATAATGGTGGAGAGTACACTGCTAACAGTTTGAAACTTTTTTGCATAAATAGAGGTATTAGTTTAGAATACACATTACCGTACACGCCACAACTTAATGGCATATCAGAACGAATGAACCGCACATTATGCGACAAAACGAGGACTCTATTAGCGGAAACCAATTTGCCAAAACATCTGTGGTGCGAAGCAATACAATGTGCAGTTTACCAATTAAACAGATCGCCATCATGGGCCATAAGCTTCAAGACACCCAGCGGAATATTTTTTGGTAAAAACGACATATCGAGATTGAGAGTATTTGGTTCCAAAGCTTGGGCTACTATAGTACCCAAACCGGACAAGTTTGCCAAGAGAGCAAAAGAAACAAGAATGGTAGGTTATGGAACTGTTGGTTACAGATTATGGGATCCAGAAGAAGATAAAATAGTTATTTCCAGAGATGTAAGATTTGATGAAAGCGACATTAAATTCAAAAACAAAGAAGAAGTGAAACAAGTTAGATATATTCAAGACAAAGAAGAAGAAATCAATAAAGAAAAGCAAGATATTGTAGAACAGGAAGATGAATTTAAAGATGCAGAAATGAACACTGATCAAATTGAAGAAGCAATAATCAGACCCAAAAGAACGATAAATCCTCCTGCTTATCTTAAAGATTACGAGACGAATATAGAAAACATAAATGAAACTAATATTGTTATATGTCTGAGTGCAAATGCACCAGAAACTTTCGAAGAAGCTATAAAAGAACCAGAATGGAAAAACGCAATCAATAAAGAACTAGATGCACTCCAAAGACTAGAAACGTGGGAAGAACAAGAAATAACCGATGGAAGAAAGCTCATTGATACAAAATGGATATTTAAACTAAAAGAAGATGGAACAAAAAAGGCAAGACTGGTAGCTAGAGGCTTCCAACAAAAGAAAAAAGATATTTTTGACAGCGTTTATGCACCCGTTGCTAGACATTCTACCATAAGAATGATCTTATCAAAAGCTGTACAAGATGATTTAAAGATTATTCAACTAGACATTCCCACTGCATTCCTAAATGGAAAATTGAAGTCTGATGTATTTATCAAAATACCCCAAGGATTAGAAATAAAAAATAATAATACAGCATTAAAACTAAAGAGAGCATTATATGGATTGATTGAATCACCAAAATGTTGGAATGAAACACTTGACGAATTTGCGAAAGCTAACGGATTCCAAAGATCAGAATATGATTACTGTTTGTATTACAAAGAAGATTGCTGGATGCTGATTTACGTGGACGATACCTAA
Protein
MCYDDESNLQQFFLKFEGILSELAAINVSVEVEDQICYLLSSLPKIYDQLITSIETMGSEKQLNIEFVKARLLDMETKLKMDRNSEGYENNAFITCHSCGKRGHKSFECRSGRGQAPSRGQSLTRGRSYPRSCGRSFRGNSSSRHTTYQHASAAGTENKEIGFIASDIIANVGECGNIELIIDSGCTEHLINEKYENYMTDITYLDKHVKIFVANGQCITTSKRGKLKVKYQNTTINIDALIVKDVSYNLLSVKKIVEAGFNINFNKYNVKIFNKKTFLRGIVQGKLYKLQAELCKSEVCNITDATDLWHKRLGHLNRKSLNILNLPVSNRICSPCMEGKATRSPFTPIPKPRTKMTAEMLHTDIAGPIRHQGPNGEKYFMKIIDDFSHFCVVYPLKSKSEATERLMNYVLRIENETGNKVKRIRCDNGGEYTANSLKLFCINRGISLEYTLPYTPQLNGISERMNRTLCDKTRTLLAETNLPKHLWCEAIQCAVYQLNRSPSWAISFKTPSGIFFGKNDISRLRVFGSKAWATIVPKPDKFAKRAKETRMVGYGTVGYRLWDPEEDKIVISRDVRFDESDIKFKNKEEVKQVRYIQDKEEEINKEKQDIVEQEDEFKDAEMNTDQIEEAIIRPKRTINPPAYLKDYETNIENINETNIVICLSANAPETFEEAIKEPEWKNAINKELDALQRLETWEEQEITDGRKLIDTKWIFKLKEDGTKKARLVARGFQQKKKDIFDSVYAPVARHSTIRMILSKAVQDDLKIIQLDIPTAFLNGKLKSDVFIKIPQGLEIKNNNTALKLKRALYGLIESPKCWNETLDEFAKANGFQRSEYDYCLYYKEDCWMLIYVDDT

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Keywords
Aspartyl protease   Complete proteome   Endonuclease   Hydrolase   Metal-binding   Nuclease   Nucleotidyltransferase   Protease   Reference proteome   RNA-directed DNA polymerase   Transferase   Transposable element   Zinc   Zinc-finger  
Feature
chain  Retrovirus-related Pol polyprotein from transposon TNT 1-94
EMBL
AB014676    BAA74713.1    GDHC01015802    JAQ02827.1    GBHO01027564    JAG16040.1    + More
GBHO01004832    JAG38772.1    GDHC01019310    JAP99318.1    GEDC01012841    GEDC01000503    JAS24457.1    JAS36795.1    GBHO01035173    JAG08431.1    GBHO01034731    JAG08873.1    GBHO01009623    JAG33981.1    GBHO01002761    JAG40843.1    GDHC01007058    JAQ11571.1    GEZM01072005    JAV65635.1    GEZM01042286    JAV79968.1    LJIG01022881    KRT78250.1    GEZM01028916    JAV86196.1    LBMM01012492    KMQ86193.1    JAV86195.1    GBHO01034936    JAG08668.1    JXUM01155348    KQ572178    KXJ68066.1    GBBI01004033    JAC14679.1    LBMM01007046    KMQ90088.1    GEHC01000928    JAV46717.1    GEZM01098220    JAV53943.1    GGMR01018348    MBY30967.1    ABLF02041793    GBHO01002616    JAG40988.1    JXUM01025857    KQ560736    KXJ81076.1    JXUM01085595    KQ563513    KXJ73717.1    GEHC01000878    JAV46767.1    JXUM01011189    KQ560325    KXJ83029.1    GFTR01008662    JAW07764.1    KK112142    KFM56833.1    JXUM01136904    KQ568499    KXJ68982.1    GECZ01025604    JAS44165.1    LBMM01010924    KMQ87150.1    LBMM01012772    KMQ86003.1    NKQK01000002    PSS35035.1    GEZM01032204    JAV84770.1    GEHC01000966    JAV46679.1    GAKP01015342    JAC43610.1    KQ483843    KYP40337.1    CM003608    KYP66486.1    GECZ01019212    JAS50557.1    KQ484038    KYP38095.1    X13777    GDUN01000694    JAN95225.1    GAKP01010102    JAC48850.1    GEDC01029908    JAS07390.1    AY009101    AAK12626.1    FJ544857    ACL97387.1    FJ544854    ACL97385.1    JN402333    AFB73912.1    CM007893    OTG30017.1    KQ484186    KYP36645.1    PDCK01000039    PRQ60431.1    CM003607    KYP67664.1    OIVN01006239    SPD28653.1    GEZM01063091    JAV69316.1    JN402332    AFB73911.1    KQ483417    KYP53032.1    KQ483702    KYP42748.1    FJ544853    ACL97384.1    LBMM01012645    KMQ86082.1    OIVN01000404    SPC79669.1    KQ485623    KYP31853.1    D83003    BAA11674.1    KQ483890    KYP39660.1    OIVN01004879    SPD19723.1    OIVN01002564    SPD04723.1    OIVN01000557    SPC82046.1    OIVN01000189    SPC75922.1    OIVN01002854    SPD06945.1    KQ483456    KYP50361.1    NKQK01000016    PSS08126.1    KQ483522    KYP47640.1    KQ484324    KYP35753.1    ASHM01014005    PNX95963.1    OIVN01000313    SPC78143.1    OIVN01000991    OIVN01001835    SPC88370.1    SPC98114.1    OIVN01002055    SPD00174.1    JYDL01000068    KRX18751.1    OIVN01001130    SPC90232.1    OIVN01002656    SPD05381.1    GEHC01000959    JAV46686.1    KF740825    AIC77183.1    FJ544856    ACL97386.1    FJ544851    ACL97383.1    JXUM01099923    KQ564528    KXJ72133.1    CM003610    KYP61818.1    KYP63036.1    KQ485638    KYP31826.1    AF279585    AAK29467.1    OIVN01002247    SPD01987.1    ASHM01015075    PNX96991.1    GAMC01008189    JAB98366.1    OIVN01002516    SPD04274.1    JXUM01060983    KQ562129    KXJ76624.1    KYP61490.1    CM003606    KYP68287.1   
Pfam
PF00665   rve        + More
PF07727   RVT_2
PF13976   gag_pre-integrs
PF00098   zf-CCHC
PF13961   DUF4219
PF13358   DDE_3
PF16495   SWIRM-assoc_1
PF08534   Redoxin
PF00106   adh_short
Interpro
IPR036397   RNaseH_sf        + More
IPR039537   Retrotran_Ty1/copia-like       
IPR001584   Integrase_cat-core       
IPR013103   RVT_2       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR025724   GAG-pre-integrase_dom       
IPR025314   DUF4219       
IPR038717   Tc1-like_DDE_dom       
IPR032451   SMARCC_C       
IPR036291   NAD(P)-bd_dom_sf       
IPR013740   Redoxin       
IPR020904   Sc_DH/Rdtase_CS       
IPR002347   SDR_fam       
IPR036249   Thioredoxin-like_sf       
IPR037944   PRX5-like       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF50630   SSF50630       
SSF51735   SSF51735       
SSF52833   SSF52833       
Gene 3D
PDB
3S3N     E-value=1.88339e-08,     Score=144

Ontologies

Topology

Length:
855
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02533
Exp number, first 60 AAs:
0.02515
Total prob of N-in:
0.00137
outside
1  -  855
 
 

Population Genetic Test Statistics

Pi
491.171727
Theta
196.709672
Tajima's D
4.792486
CLR
0.825076
CSRT
0.999950002499875
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号