SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16191
Pre Gene Modal
BGIBMGA013961
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_uncharacterized_protein_LOC106709759_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 2.744
 

Sequence

CDS
ATGTCTTCCAAATCAACTTCGAGCGTAAAAGGCAACACCAGAGCTGACCCGAAAACAGGGACGCGAGGAACTGATCGTGTCCTCAAAATATCTCGTCTGGAAGCACCCGACATGGTAATGAGGGAGGAGAAGAGGAAGAAAACCCAAGCTCCTCTGCCCAACACCGAAAAAGGGGACACTCCGGTCAGCCTAGCCACTATCCTAATAACCCCCTCAGACGCTGGCACTGGACATGCCGGTGACACAAAGGAGAAACACCCCTTGACCGTAGCAGAAACACAAGAAGCACAACAGTTACGGGGTGGAGCTGCATCATTAAGAATCAAAACGCAATTAAGGCAGGCCAGTGTAGCTGAAGAAATGTCGGCTCTAACCACCTCAGACTGCCTCGAAGACCTTGAGGACAGAAAAAGCACGGACGGCCGATTTTCACTCAACAACTCATCAAGCGCTGGACCAAACAGGTTAATGAATGGGCTTCCAAAACGAGCAAACGAAATACTACAGGAGGCCAAGGCAGAGTTGGAGAGATCGGGAAACCTCAAAAGGGAGATAAGAGAAAATGTGGTCGCATCCCTTCAAGAGTTGTATGAGATGGTACTAAGACTAGCCGACTCACGCATTTTACTCATGCTCGAGGCCCATAGAACCAAACCAAATGAAACGAAAAACATTGACAGAATCAGAGCCAAGCACACAAACGAGTTGAAAGATGCCCTCAACAAATATGAAGAACTGGATGGCCATATTCTAACACTCAACAAAGACACGGAAATGGTACGACAAATAATCCTGAGAGACGTTCATGATGAATTAGCAAAGGTTAGACAGAACCAGGAAAACTCCTCTAAGGAAATTAAGAATACCCTAACAGAGTTAAATACCCAAGTACAGAACATAAATAGTCAGATCACGAACATCCAAATGCATATTGGGACAAATACAGCAAATACTCTACCCGAATTGGAGGAAGTGAACAGGCGAATACAGGAAGTCCAAGACACCCTACTTCACTTTACACAGGTACCGAAAAAATCGACGGAGGAAAGACAAGATAAAACTCCAATTGAAACCTCATACCTGAGAGACACCATACAGAAGTCGGTCGAAACCGCCCTTGAAATTAGTGAACTAGGGGTAATCAAGGAACTCTGCAGCGATACCAATCAAAAGATGGCCGAAACCAAGGATAACACTGCAACTCTCCTGGGACGGACCAACAAAGATGAAGAAATGGGAAGAGCTCTAAAATCAGAAATAACAAAAATCAAGGACGACATAGCAGATCTAAGAGATGTGTCAGTGGAAGCAGTGGCCCCCATCCGTACGGCCATTGAAGAGATAAGAGGAGAAATTAAAACATCAGAGAGACGATCAAATAGGATACCAGAAAATGTGGAAGGACAAAGAAAGAGTAAAATCCCGTCAAGAGTACCACCAACTGATCCAAATTGGCCAATAGTACTTGAATCAGTAGATCCCCGCTCAACCAGCGACGATATCATAAAAAACGTTAAAGGCAAAGTAGACCCTGTCGCACTAGGAATAGCTATCAATGGAATCAGGAAGATCCGAAACCAGAAGGCCATAGTCTGCTGTGATTCTGAGAAGGATCGCAAAGCCTTTTGCCAGGCTCTCAAGAACGCAGAACCCAAGCTGTCAGCCAAGATCCCCAGCACCAAAAACCCACTACTAAAACTCCCAGGGGTAGCTAATGACATGACCAACAGCCAGATAGAAGAAGCAGTCATTAAGCTGAACAAAAGACTTTTGGTGGAGGTGGAAAACAAAGATCTCAAGGTCAAGGTGCAGCGAAGAACAAAGGGAAGGAACTCACTGGTGGCCAACGTAATTTTGGAAGTCAACTACAAGATATGGACCAGACTAAAAGATCAACGCTTAAAAATAGGCTATCAAGTGGTGACAGCTACAGATCACTCCCCAATCAGACAATGTTACAACTGCCTAGGATTCGGTCATTTGGCTCGAGATTGCAACCAAGAATCCAACAACAAAATCAAAGTCATACAAGCCAATCTGGGGAGGGGTCAAGCTGCCACTCAAGAATGCCTGGCAACGGCATCCCTGGATGAATTTTCCATCGCGCTACTGCAAGAACCTTATGTTGGAAATAAAGGGATACTATCAACTAGAAACAGGATCATACAGGATAAAGGGGACAAGAATAATCCTGTCAAATCTGCCATTGTGATATTCGACAGAAGTCTGGTAGTAATTGAAAATAATTTACTCATAGATCGTAACATAGTAGCTGTTACGATAGATACACAGGGACATAGAATCGGGTGCATCTCAGTGTACTGGGAGGATTACGTGAACGTGGACACATATCTAAACAAACTGCAATACGTAATCAACAATCTAAAAACGGACACTTATATAGTTGGTGGTGATGTAAACGCTCGTAGCCAGTGGTGGGGATGCCCCAACGACGATTTAAGAGGAGCGGCTATCGCCGTTTTCTTAGCCCAGAATGATCTCCAAATACTAAACAAAGGAAACACCCCTACATTTTGGACTGTCAGACAAAACAGGCTGTACACAAGTATAATAGATATAACGGCATGCAGTGACGGACTTCTCAACTCAATATCAGATTGGAAAGTAGATGAGAATCTAATCACCACCTCCGATCATCGCTCAATCACGTTCAGCGTCGACCTTACCGGGGACAGAGATTCTCAGAAAGGAAATCTTACCACTACAAAGAAATACAATACTAATAAAGCAAACTGGCCTAAATTCAAAAATAAACTACTGGAGCAATTCTCTGAACGAAATATCACAGTTGAAACCATCGCCTCAAAAACTGACAACGAAGAGTTCAACAAAATGGTAGAGGACTACGCGGGATGCATTGCGGTAGCCTGTGATTCCGCGATTCCTCTGATTGACCATAGTAAAAATCAATGTAGGCTATCCTGGTGGACCAAAGAACTAACCGAACTTAAAAATGAGGTTAAAAGAATCAGAAGCAAGATTAGGAAGGCAAACCCTAGAAGAAGGCCGCTTCTGATAAAAGATTATCAAGAAAGGTTAAAAGAATATAAACACACAATAATCATAACGAGGACCACCAGTTGGAAAGAATATACATCACGACAGAAGAGAGAATCGATGTGGGATAAATTCTACCGCATTATACGTACTAATAATAGAAGCAGAGATGAGGTAATGCTCAAGAAAGGGAATGACGTCCTCGACCCCCTCAAATCCGCAGAACTACTAGCTGATACATTCTATCCTAAGGACAATAAAGATATCGAAAACGAAGAACATCACCGCATACGAGAGGTGATAGCTGCATGGAGGAAGAAAATAATCGAAGAGAAGGACCCAGAATTTAAAGAAAAGCCGTTCACACCGAAAGAAATACAAACGGTAATCCAAAATATGAGCCCGAAAAAGGCTCCAGGCTATGATGGCTTCACATCAGACATTTGCACCAAGGCGATAGAAGCAAACACAACTATATTCCTCACCATCCTGAATCAATGTCTGACCCTCACAATCTTCCCGAAGATTTGGAAGCAAGCCATCATAAGGATTCTCAGGAAACCAGGGAAAGAATCATATATTACTCCCAAATCATATAGACCTATAGGCCTGCTTCCGGTACTGGGCAAGGTTTTTGAGAAGGCCCTAGTCAACCGTCTCCAGTGGACCCTGGGAAATGGAAACCACCTCAGTAATAGGCAATACGGCTTTCGACCTCAAAAAAGCAATGAGGATGCGCTATACAGACTCACGAACCTGGTGACCCAAAACGTGAACCAACACAAAAAAATTGTAGCTATGGTGAGCTTGGACATTGATGGGGCGTTTGACAACACCTGCCCGCAAATCTGGCTGGTCATCGATGACTATCTGCGTGATCGAAAAATCAACCTCCAGTATGCGGGATGTACAGTAATCCGATACACAGAAAGGGGCTGCATCCAAGGCTCCACTTGTGGCCCCTTGATGTGGAACCTGCAGCTGGATCCACTCCTGGCCGAAGTGAAACATCTGGACGCACACATACAGGCCTTCGCGGACGATATTGTCATTGTAGCATCAGCGGACTGTACTACCGAGCTGAACGACAAAGTCAACACAGCTCTGGAAAAGATAGCCAACTGGGGAAGGACCAACAAAATGAAGTTTGCCGATCACAAAACACAAGCCGTCATTTTTACGAAGAAACTAAAATACGACCAGCCTAGTTTCTACCTTAACAACACTCCGATCAAATTGGCCGATAAGATGACAATTCTGGGTTTAACCTATGACAGAAATCTAAACTTTAGACCCCATCTGGAACGAATCACAGGAAAAGCCCTAAATATCTATAAGGCAATAGCCCAAGCGGCAAAAGCAACTTGGGGACTGAACCCCGACATCATCAGAATTATATACACGGCAGTCATAGAGCCCATTATGCTATACGCTGCAAGTTCATGGGCAATCGCTACGAACAGAGAGTACATTAGGCGTAAACTAGACAATCTATCCAGGATATTCGCCATCAAAATATCGAAAGCTCACAGGACAGCCTCATACACATCAGTGCTCCTTTTGGGAAGAATCCTACCGCTCGACCTCCGGATAGCGGAGGCTGCTGAGCTATACAAAATCAAAAATGGCTCGCCGATCCCCATGCTACCAGGTAGACCTATAGAAAAGAGAACAAGCATATATAGACTACCCCATCCAGCCTGTAGAGATGACCTACACTTCAAGATATTACAAACCCAAGAAGAGCTGATAGAGGTAACAAACAAAACCCCGACCATTTATACCGACGGGAGTAAACTAGAAGGAAGAGTCGGTGGAGCTGCAACTTGGTGGGAACAGGGGGAAGAGAGGAAATCCAAAAGCTTCCGTTTAAACCCTTACAACTCAGTCTTCCAGGCGGAAATAGTCGCAATACAAGAAGCACTAATGATGATAGCAAAATCACAACATAAAGTAGTCAACATCATTAGTGACTCGAGATCTGGGCTGCAGGCCATTATTAACACCAACACTACTCACCCATTAATCTTTAATATACAAACCACCATGAGGAACTTGGCCAGTATGAACAAGACAGCAAACCTGTTCTGGATAAAGGCCCACGCCGGGATACCAGGCAATGAAAGAGCTGACGAACTAGCAAAAAAAGCAGCCTTAACTAACAAACAGGCACCAAAATACGATGGAGTCCCACTATCATATGTACGACACACACTAAGGCAAACCACCATAGACAAATGGCAACAAAGATATACTGAGGCAACGACGGGAATGACTACAAAGATGTTCTTTGTAGATGTTCGCCGCGCCCACAAGATACTTAGTAAAATGAAAGTTAACAACATCATAGCACAGCTCTTAACTGGCCACGGTGGGTTCGGCGAATATCTATTTAGGTTCAAACTCAAAAGCAATCCCTACTGTGAGTGTGGTGGCGGGGTCTGTGAAACTGTCCTCCACATTCTAACAGAATGTCCTAGGTTCGGATTTAGACGCATAGAAACAGAACAGATCTTGGACTTTGCCATGGACACTCAAAACTTCCCCAGTATTATCGAGGACGACAGTGCTAGAGAAGCGTTCCTGAAATTTGCTATAAACAGTATAAAAATTGCCAACAACAGAAATAATAGTATAATGAAATACGCTATAGATTAA
Protein
MSSKSTSSVKGNTRADPKTGTRGTDRVLKISRLEAPDMVMREEKRKKTQAPLPNTEKGDTPVSLATILITPSDAGTGHAGDTKEKHPLTVAETQEAQQLRGGAASLRIKTQLRQASVAEEMSALTTSDCLEDLEDRKSTDGRFSLNNSSSAGPNRLMNGLPKRANEILQEAKAELERSGNLKREIRENVVASLQELYEMVLRLADSRILLMLEAHRTKPNETKNIDRIRAKHTNELKDALNKYEELDGHILTLNKDTEMVRQIILRDVHDELAKVRQNQENSSKEIKNTLTELNTQVQNINSQITNIQMHIGTNTANTLPELEEVNRRIQEVQDTLLHFTQVPKKSTEERQDKTPIETSYLRDTIQKSVETALEISELGVIKELCSDTNQKMAETKDNTATLLGRTNKDEEMGRALKSEITKIKDDIADLRDVSVEAVAPIRTAIEEIRGEIKTSERRSNRIPENVEGQRKSKIPSRVPPTDPNWPIVLESVDPRSTSDDIIKNVKGKVDPVALGIAINGIRKIRNQKAIVCCDSEKDRKAFCQALKNAEPKLSAKIPSTKNPLLKLPGVANDMTNSQIEEAVIKLNKRLLVEVENKDLKVKVQRRTKGRNSLVANVILEVNYKIWTRLKDQRLKIGYQVVTATDHSPIRQCYNCLGFGHLARDCNQESNNKIKVIQANLGRGQAATQECLATASLDEFSIALLQEPYVGNKGILSTRNRIIQDKGDKNNPVKSAIVIFDRSLVVIENNLLIDRNIVAVTIDTQGHRIGCISVYWEDYVNVDTYLNKLQYVINNLKTDTYIVGGDVNARSQWWGCPNDDLRGAAIAVFLAQNDLQILNKGNTPTFWTVRQNRLYTSIIDITACSDGLLNSISDWKVDENLITTSDHRSITFSVDLTGDRDSQKGNLTTTKKYNTNKANWPKFKNKLLEQFSERNITVETIASKTDNEEFNKMVEDYAGCIAVACDSAIPLIDHSKNQCRLSWWTKELTELKNEVKRIRSKIRKANPRRRPLLIKDYQERLKEYKHTIIITRTTSWKEYTSRQKRESMWDKFYRIIRTNNRSRDEVMLKKGNDVLDPLKSAELLADTFYPKDNKDIENEEHHRIREVIAAWRKKIIEEKDPEFKEKPFTPKEIQTVIQNMSPKKAPGYDGFTSDICTKAIEANTTIFLTILNQCLTLTIFPKIWKQAIIRILRKPGKESYITPKSYRPIGLLPVLGKVFEKALVNRLQWTLGNGNHLSNRQYGFRPQKSNEDALYRLTNLVTQNVNQHKKIVAMVSLDIDGAFDNTCPQIWLVIDDYLRDRKINLQYAGCTVIRYTERGCIQGSTCGPLMWNLQLDPLLAEVKHLDAHIQAFADDIVIVASADCTTELNDKVNTALEKIANWGRTNKMKFADHKTQAVIFTKKLKYDQPSFYLNNTPIKLADKMTILGLTYDRNLNFRPHLERITGKALNIYKAIAQAAKATWGLNPDIIRIIYTAVIEPIMLYAASSWAIATNREYIRRKLDNLSRIFAIKISKAHRTASYTSVLLLGRILPLDLRIAEAAELYKIKNGSPIPMLPGRPIEKRTSIYRLPHPACRDDLHFKILQTQEELIEVTNKTPTIYTDGSKLEGRVGGAATWWEQGEERKSKSFRLNPYNSVFQAEIVAIQEALMMIAKSQHKVVNIISDSRSGLQAIINTNTTHPLIFNIQTTMRNLASMNKTANLFWIKAHAGIPGNERADELAKKAALTNKQAPKYDGVPLSYVRHTLRQTTIDKWQQRYTEATTGMTTKMFFVDVRRAHKILSKMKVNNIIAQLLTGHGGFGEYLFRFKLKSNPYCECGGGVCETVLHILTECPRFGFRRIETEQILDFAMDTQNFPSIIEDDSAREAFLKFAINSIKIANNRNNSIMKYAID

Summary

Uniprot
Pfam
PF14529   Exo_endo_phos_2        + More
PF00075   RNase_H
PF00078   RVT_1
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR012337   RNaseH-like_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR036397   RNaseH_sf       
IPR002156   RNaseH_domain       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
Gene 3D
ProteinModelPortal
PDB
1WDU     E-value=2.74662e-37,     Score=396

Ontologies

Topology

Length:
1891
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.23059
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1891
 
 

Population Genetic Test Statistics

Pi
320.114824
Theta
212.580976
Tajima's D
2.224082
CLR
0.237636
CSRT
0.913804309784511
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号