SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16188
Pre Gene Modal
BGIBMGA013928
Annotation
PREDICTED:_facilitated_trehalose_transporter_Tret1-like_[Papilio_machaon]
Location in the cell
PlasmaMembrane   Reliability : 4.412
 

Sequence

CDS
ATGGCGGGCTCGAGGGAGCGTCTCCTTTACGAGAGGAAGCCTGATTACGACTCCGAATACTATCGTCAAAGATTCGAGCTACACGATCGGGAATCGAACAGGAATCGGCAGGAACAAAAGCCGCCGCGCTACTACAGACCGAAACGTACCAACGGGTACGTCTACGAAGACATATACTCGGACTTCGACGAGGCGCAGGGCCGGCTGTCCCTGTTCAGGCCAATCAGACCGGAGTACCTAAACCTGCCGACTTCGTATGACGTTAAATACAATTCCCTACCCCGAAACTACTTCGATTACGACGAAAGACGAAGAAACAGGAAAGACAATTACGATTTTCGAATCCATAACGAGAGGAGGAATGCCGAGTATTACCGGAAAAGGCCGAGAGAGGTCGTGAGCGAAATACGAAATTCAAAGCCCAAGAACGTGGCGGTCTGCAAGCCGTTACGTTTCGAAAAGAACGCTCGGTATTGGACCACGGACCCGCCCGAGCGCGGCCGAACACGCCCGAAGAAACCCGACGAACCAAAGAAGAACGTTAAGTTCTCCGAAGTTTCCGGCTGCAATCGTAAAATGATCGTAGACGACCCGATCGTAGGCCGGAAAATCGTCCCAGTGCGCGAACTCGAAGTGTCTCTAGACCAAATGATTCAGAGTGGATATTTCGAGAAGCATAACATTCCTATATCTAGGCCGTTGAAAGATGCAGAGGAAAAGATAAGCGCGTTGGAGCCGACGAGAGTGGTGCCAAACGGGAAGTGTTTATCGGACCAGCCCAGGAACGAAAATGTCGCAGTCAGGAAGACTAGGCATTTACCGCAGGTCTTGGCAGCCCTTGCTGTGTCTCTGGCGCCATTCTCAGCTGGTCTCGGTAAGGGCTACAGTTCTCCGGCCATCGCTTCTCTTCAAGGACCTGGAGCCAATGCCACCAGAAGGGATTTCCAGTTGACCGACCAGCAGGCGAGCTGGCTAGCATCACTGTCGTTTCTTGGGGCGCTCTTCGGTGGAATGGCCGGTGGTGCCGCCATGAGGCACGGGAGACGCCGCGTCCTCTCATTAGCAGCAGCGCCCTGCAGTCTATCCTGGTTGCTGACAGTACTGGCTACGTCAGTCAGGATGATGTGCATTACTGCCTTCCTGGGAGGGTTTTGCTGCTCCATACTAACCATGCTATCTCAGGTGTACATCAGTGAAATCTCAGTGCCTGACATAAGAGGATGTCTGAGCGCGGTTTTGAAGATCGTCGGCCATCTTGGAGTACTCTTTAGCTTCACTATAGGAGCGTATTTGGATTGGCAACAATTAGCTCTGTGCATTTCTGCTGCTCCCCTACTACTTTTTTGCACAGTTCTATACATCCCGGAGACCCCCAGCTACCTTGTTCTGATCGGTAAAGACGAAGAAGCTTACAAAAGTCTTCTATGGCTACGAGGTCCTGATTCAGATGTTGCACAGGAGCTAGCCACGATTCGTACTAACGTGCTGGCTAGCAAGAATTTCAGTCAACGCCACCAAATATCCAATGGTCAATTGTTTAGTTCTCTTGACGCTAGGACCATGAATCGGTTGCTTGGGCCCATCATTGTGACCTGCGGTCTGATGATGTTCCAAAGACTGTCTGGAGCCCATGCATTCTCGTTCTACGCTGTACCGATTTTCAGGAAGACATTTGGAGGTATGAACCCACACGGAGCGGCCATTGCTGTGTCCTTTGTCCAATTACTGGCCTCTTGTCTCTCTGGGCTGCTCATCGATACTGTGGGTAGGCTGCCACTGTTAATACTCAGTTCTGTGATGATGTCAATGGCATTAGCCGGCTTCGGGAGTTACGCTTACTATGAAGAGGTCCACCGTAACCAGAGAATACAAAGCGTTATGTTCCATCAGACCGATGGTCAAAACGATTGGATCCCGCTTTTATGCGTTCTGGTGTTCACAATTGCCTTCTCACTAGGAATGAGTCCTATATCATGGTTGTTAATCGGGGAATTATTTCCCCTCGAATACCGGGCATTTGGGAGCGCAATGGCAACAGCTTTTAGCTATCTGTGCGCGTTCGTAGGAGTCAAGACCTTTGTGGATTTCCAACAGGCGCTAGGACTCCATGGGGCATTCTGGTTATACGCATCAATTAGTGTGGGGGGATTGTGTTTTGTGGTCTGTTGCGTGCCGGAGACTAAAGGGAAGGATCTCGATGAAATGGACCCGAATTATGTACAAAGTTTGTCCCCTAAAAGATGTGAACTAGGTATATAA
Protein
MAGSRERLLYERKPDYDSEYYRQRFELHDRESNRNRQEQKPPRYYRPKRTNGYVYEDIYSDFDEAQGRLSLFRPIRPEYLNLPTSYDVKYNSLPRNYFDYDERRRNRKDNYDFRIHNERRNAEYYRKRPREVVSEIRNSKPKNVAVCKPLRFEKNARYWTTDPPERGRTRPKKPDEPKKNVKFSEVSGCNRKMIVDDPIVGRKIVPVRELEVSLDQMIQSGYFEKHNIPISRPLKDAEEKISALEPTRVVPNGKCLSDQPRNENVAVRKTRHLPQVLAALAVSLAPFSAGLGKGYSSPAIASLQGPGANATRRDFQLTDQQASWLASLSFLGALFGGMAGGAAMRHGRRRVLSLAAAPCSLSWLLTVLATSVRMMCITAFLGGFCCSILTMLSQVYISEISVPDIRGCLSAVLKIVGHLGVLFSFTIGAYLDWQQLALCISAAPLLLFCTVLYIPETPSYLVLIGKDEEAYKSLLWLRGPDSDVAQELATIRTNVLASKNFSQRHQISNGQLFSSLDARTMNRLLGPIIVTCGLMMFQRLSGAHAFSFYAVPIFRKTFGGMNPHGAAIAVSFVQLLASCLSGLLIDTVGRLPLLILSSVMMSMALAGFGSYAYYEEVHRNQRIQSVMFHQTDGQNDWIPLLCVLVFTIAFSLGMSPISWLLIGELFPLEYRAFGSAMATAFSYLCAFVGVKTFVDFQQALGLHGAFWLYASISVGGLCFVVCCVPETKGKDLDEMDPNYVQSLSPKRCELGI

Summary

Similarity
Belongs to the major facilitator superfamily. Sugar transporter (TC 2.A.1.1) family.
Pfam
PF00083   Sugar_tr        + More
PF07690   MFS_1
Interpro
IPR036259   MFS_trans_sf        + More
IPR020846   MFS_dom       
IPR005828   MFS_sugar_transport-like       
IPR003663   Sugar/inositol_transpt       
IPR011701   MFS       
SUPFAM
SSF103473   SSF103473       
PDB
6N3I     E-value=1.50943e-25,     Score=291

Ontologies

Topology

Length:
752
Number of predicted TMHs:
11
Exp number of AAs in TMHs:
241.78698
Exp number, first 60 AAs:
0
Total prob of N-in:
0.16793
outside
1  -  321
TMhelix
322  -  344
inside
345  -  350
TMhelix
351  -  370
outside
371  -  374
TMhelix
375  -  397
inside
398  -  408
TMhelix
409  -  431
outside
432  -  440
TMhelix
441  -  463
inside
464  -  523
TMhelix
524  -  546
outside
547  -  565
TMhelix
566  -  585
inside
586  -  591
TMhelix
592  -  614
outside
615  -  636
TMhelix
637  -  659
inside
660  -  671
TMhelix
672  -  694
outside
695  -  698
TMhelix
699  -  721
inside
722  -  752
 
 

Population Genetic Test Statistics

Pi
204.523933
Theta
153.982713
Tajima's D
0.982291
CLR
0.522704
CSRT
0.664966751662417
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号