SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16186
Annotation
PREDICTED:_uncharacterized_protein_LOC101740474_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.351
 

Sequence

CDS
ATGGTGTTAAATATTTGTGCTGTGTACATCCCATCTCCTTTGAATGTTGATTATGTCGACATTTTTACCAAAAATACTGTGCAGGTTATTCACAACAACATGACAAAAGGTATTTCTGAACCATTATTTCTTTTAGTAGGAGACTTTAATATGGGGGATATTGAGTGGTGTAAAGATAATTCTTCTGCATATATGACCCCATCAACATCAGGGAATAATGTCTATACAGAATTTTTAGACGCCATGTCTTACTGCGACCTTTATCAGTTTAATGATATGATCAACGCTAATAATCGAATCCTTGACTTGGTATTTAGTGGTGCGTCAAGTGATATCTCAATTGAATCTGCCAAGGGCTTTTCGACTGCACCTGACCCATACCATCCGCCACTGGACATTGTATTTCAAGAAACATCTGTGCATGTTGTGAAACCTGACTCTGCCCCAGCATTAAACTACTTCAAATCCAATTATGAGGCTCTGAATAAAGATTTAAAGCAGGTTGATTGGACCAACTTACTACAAGAATCATATTCTGTGGATACAATGGTTGACCATTTTTATCAGACGATCAGACCGTTAATCAGTCAGCATACTCCACTCCGCTTCCAACATAATGATCATTACCCAATATGGTTTAGTAATTCCTTAATAAAAGCTCTTAAACATAAACGTAAATTTCACTCCAGATACAAAAAATACGGAAATTTAATGGATAAGCTGCAATTCGATATAACAAGAAAGCGATGCGATGTAATGATAACTGAATGTTATTCCAATTTTAAACAGAATGCTCCCAATCATCTCAAAAACCGTCCGAAATACTTCTGGAAAATTTTTAAGGACAAAACAGCTAATAGTCGTTCTTTGCCTAACGAAATGAAGCTTGGTCGGGTAGAGGCTAAGGGAGGACAGGAGATCTCTGAATTATTCTCTCAACATTTCCAAAGTGTGTATGATTCCAACATTAATCATGAAACAAGTTGCTCTTCTCATTATTGTAATGTGTCCGGCAATGCATCATATAATATCGTTGAAGTTAATGAAACCGAAGTTTTAAATCAGCTAAAGCTTTTAAATGCGGACAAAGGACCTGGCCCTGATTTGATACCTCCTATATTCATAAAAAAATGTGCTCTAAGTTTATATAAACCTCTAGCGAAAATTTATACCAAATCTCTCCAAAGTAGTGCTTACCCCACTCAGTGGAAATTAGCGCACTTAACACCGATCCACAAGGATGGGAGGCTGGATGATATAGCCCAATATCGACCTGTCTCCATACTGTCTGGGTTTGGCAAGGTATTGGAAGCCATAGTTAATAAAAAACTGATAACTCATTTCAAGCAATCTATAGACACAAATCAACACGGCTTTCTGCCATCCAAATCGACAAATACTAACTTAGTTAGTTATGTTTCTGATATAATTGATACTATGGACGGAGGTGGCGAGGTGCACTCTATCTACACCGATTTCAGAAAGGCGTTTGACCTAGTTAACCATAACTGCCTATTACACAAGCTTGCAGAACTGGGCATCCATGGATCATATCAATGCGATTTACAAATGGAGTACGCAGAATTACATGCACTTGAATTTGCAAAAGTGTAA
Protein
MVLNICAVYIPSPLNVDYVDIFTKNTVQVIHNNMTKGISEPLFLLVGDFNMGDIEWCKDNSSAYMTPSTSGNNVYTEFLDAMSYCDLYQFNDMINANNRILDLVFSGASSDISIESAKGFSTAPDPYHPPLDIVFQETSVHVVKPDSAPALNYFKSNYEALNKDLKQVDWTNLLQESYSVDTMVDHFYQTIRPLISQHTPLRFQHNDHYPIWFSNSLIKALKHKRKFHSRYKKYGNLMDKLQFDITRKRCDVMITECYSNFKQNAPNHLKNRPKYFWKIFKDKTANSRSLPNEMKLGRVEAKGGQEISELFSQHFQSVYDSNINHETSCSSHYCNVSGNASYNIVEVNETEVLNQLKLLNADKGPGPDLIPPIFIKKCALSLYKPLAKIYTKSLQSSAYPTQWKLAHLTPIHKDGRLDDIAQYRPVSILSGFGKVLEAIVNKKLITHFKQSIDTNQHGFLPSKSTNTNLVSYVSDIIDTMDGGGEVHSIYTDFRKAFDLVNHNCLLHKLAELGIHGSYQCDLQMEYAELHALEFAKV

Summary

EMBL
NWSH01001974    PCG69524.1    HQ585015    AEM44817.1    ABLF02012895    GEZM01038580    + More
JAV81606.1    ABLF02019782    GGMR01012902    MBY25521.1    GGMS01012794    MBY81997.1    UZAG01001120    VDO10445.1    GGMR01014615    MBY27234.1    ABLF02022753    GEBQ01031644    JAT08333.1    GGMS01000095    MBY69298.1    ODYU01000349    SOQ34960.1    GEHC01001003    JAV46642.1    ABLF02041544    GDUN01000798    JAN95121.1    GGMR01011621    MBY24240.1    GFTR01008205    JAW08221.1    ABLF02037045    ABLF02037053    ABLF02055477    GEHC01000933    JAV46712.1    GEBQ01028810    JAT11167.1    ABLF02007491    ABLF02041729    GGFL01004858    MBW69036.1    GEHC01000951    JAV46694.1    GEHC01000958    JAV46687.1    GGFL01004857    MBW69035.1    GGMR01012758    MBY25377.1    GGMR01004539    MBY17158.1    KU543686    AMS38377.1    GEHC01000920    JAV46725.1    KU543681    AMS38367.1    GEHC01000932    JAV46713.1    GGMS01017711    MBY86914.1    ABLF02043063    ABLF02022364    ABLF02041596    NEVH01016945    PNF25017.1    NEVH01025296    NEVH01016302    NEVH01006564    PNF15439.1    PNF25825.1    PNF37995.1    NEVH01018377    PNF23575.1    NEVH01021219    PNF19791.1    UYWW01005329    VDM14076.1    KZ150413    PZC70972.1    GEGO01005479    JAR89925.1    UZAG01001867    VDO12276.1    ABLF02024957    ABLF02029841    ABLF02036778    ABLF02043798    ABLF02055437    ABLF02064098    ABLF02065446    AB607192    BAK26811.1    GANO01004402    JAB55469.1    GBBI01004290    JAC14422.1    GDUN01000797    JAN95122.1    ABLF02010251    ABLF02035981    GDUN01000801    JAN95118.1    GBXI01008013    JAD06279.1    GECZ01031653    JAS38116.1    KZ150047    PZC74482.1    GGFJ01001499    MBW50640.1    GGFJ01001500    MBW50641.1    ABLF02054879    GDHC01015308    JAQ03321.1    GGMR01011552    MBY24171.1    GG694238    EFA13486.1    EFA13485.1    FLMD02000119    SCV65652.1    ABLF02012883    ABLF02018804    ABLF02024880    GEHC01001005    JAV46640.1    GGMS01005024    MBY74227.1    GGFJ01001498    MBW50639.1    GDHC01002190    JAQ16439.1    EFA13487.1    GG694237    EFA13482.1    GGMR01006441    MBY19060.1    EFA13480.1    ABLF02024888    NEVH01001352    PNF42915.1    GDUN01000793    JAN95126.1    NWSH01000614    PCG75292.1    GEZM01097911    JAV54049.1    ABLF02041243    QOIP01000012    RLU15713.1    GGMS01014696    MBY83899.1    NEVH01025142    PNF15711.1    NEVH01021194    PNF20040.1    NEVH01010477    PNF32532.1    NEVH01017475    PNF24177.1    GGMR01011073    MBY23692.1    NEVH01020939    PNF20522.1    GGMS01000798    MBY70001.1    NEVH01008240    PNF34337.1    EFA13484.1    DNUT01000305    HBI40457.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF05485   THAP
PF05699   Dimer_Tnp_hAT
PF14291   DUF4371
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR019786   Zinc_finger_PHD-type_CS       
IPR011011   Znf_FYVE_PHD       
IPR019787   Znf_PHD-finger       
IPR013083   Znf_RING/FYVE/PHD       
IPR006612   THAP_Znf       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
IPR025398   DUF4371       
IPR001965   Znf_PHD       
SUPFAM
SSF56219   SSF56219        + More
SSF57903   SSF57903       
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
537
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00873999999999998
Exp number, first 60 AAs:
0.00594999999999999
Total prob of N-in:
0.00173
outside
1  -  537
 
 

Population Genetic Test Statistics

Pi
274.644897
Theta
200.870324
Tajima's D
1.105276
CLR
335.534175
CSRT
0.688065596720164
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号