SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16137
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.666
 

Sequence

CDS
ATGACGAACAGCATCTTTCCCGCGGCGTGGAAAGAAGCTGACGTTATCGGCATACACAAGCCGGGCAAATCGAAGAATGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCCGCGATAGGCAAACTGTATGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAATAAAATTCTCATAGACGAGCAGTTTGGATTCCGCGCCAGATACTCGTGCGTCCATCAAGTGCACCGCCTCAGGGAGAACATCTTACTAGGGCTGAATAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGTCAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAAACGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTCCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATTGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACTCCACGCTGAGCATCCCCCTCCCGACTAGGCGCGTCAACACCCCCGCCCCCGCCATTCGCCCAATCACGATGTTCGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCTCACATCAAGACGGTACGCGACCGTGCCGCCTTCATTCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCACTCACTTAAAATCATTCCAAATTATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTATGA
Protein
MTNSIFPAAWKEADVIGIHKPGKSKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARYSCVHQVHRLRENILLGLNRRKPIPTGALFFDIAKAFVKVWHNGLIYKLYNMGVPDRLVLIIRDYLSKRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNSTLSIPLPTRRVNTPAPAIRPITMFDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDL

Summary

EMBL
AB018558    BAA76304.1    AB055391    BAB21761.1    U07847    AAA17752.1    + More
KC165845    AFY12622.1    KQ459259    KPJ02068.1    KQ459265    KPJ02064.1    AF081103    AAC72921.1    AF081101    AAC72919.1    KQ459580    KPI99178.1    GEZM01008457    JAV94772.1    GGMR01019198    MBY31817.1    KQ973342    KXZ75569.1    GALX01005359    JAB63107.1    ABLF02014862    ABLF02014866    ABLF02061908    ABLF02008933    GGMS01004685    MBY73888.1    KQ971729    KYB24751.1    KK117880    KFM71667.1    GFTR01008038    JAW08388.1    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02042518    ABLF02057746    ABLF02003961    ABLF02059872    ABLF02033757    GBBI01004571    JAC14141.1    NEVH01005938    PNF38077.1    NEVH01000280    PNF43672.1    NEVH01001355    PNF42855.1    NEVH01010546    PNF32261.1    GGMR01016114    MBY28733.1    NEVH01003017    PNF40781.1    NEVH01007443    PNF35684.1    NEVH01023962    PNF17612.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01018383    PNF23463.1    NEVH01020071    PNF21969.1    GALX01005299    JAB63167.1    NEVH01019964    PNF22161.1    RPOV01000134    RPJ78669.1    NEVH01006754    PNF36554.1    NEVH01007838    PNF34986.1    NEVH01023961    PNF17613.1    NEVH01014858    PNF27387.1    NEVH01002716    PNF41415.1    GEZM01038405    JAV81653.1    GGMR01018716    MBY31335.1    KK113014    KFM59099.1    NEVH01011985    PNF31054.1    GBBI01004395    JAC14317.1    GGMS01008766    MBY77969.1    NEVH01009134    PNF33528.1    JXUM01155316    KQ572171    KXJ68070.1    GGFJ01002256    MBW51397.1    NEVH01027074    PNF13841.1    GGMR01003407    MBY16026.1    NEVH01017559    PNF23833.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    GGFJ01002257    MBW51398.1    NEVH01026154    PNF14491.1    NEVH01017470    PNF24199.1    JRES01000644    KNC29657.1    NEVH01019376    PNF22596.1    GGFJ01001842    MBW50983.1    GGMS01000737    MBY69940.1    GGFJ01001843    MBW50984.1    NEVH01019080    PNF22876.1    GGFJ01001844    MBW50985.1    S59870    AAB26437.2    ABLF02066620    NEVH01021205    PNF19912.1    NEVH01006721    PNF37225.1    NEVH01020963    PNF20308.1    GGFJ01001858    MBW50999.1    GGMS01002992    MBY72195.1    GGMR01000676    MBY13295.1    NEVH01026386    PNF14434.1    NEVH01006736    PNF36716.1    AF012049    AAC24972.1    NWSH01000032    PCG80497.1    GGFJ01001857    MBW50998.1    GGMS01012005    MBY81208.1    ABLF02008463    GFXV01006424    MBW18229.1    NEVH01012089    PNF30491.1    NEVH01007393    PNF35987.1    NEVH01007578    PNF35646.1    ABLF02024246    GEZM01053022    JAV74219.1    KL813758    KFM83187.1    NEVH01012084    PNF30905.1    LBMM01010106    KMQ87671.1    KK117974    KFM71881.1    NEVH01016302    PNF25823.1    GFXV01007093    MBW18898.1    GFTR01008262    JAW08164.1    ABLF02015541    LBMM01014395    KMQ85192.1    NEVH01000598    PNF43535.1    ABLF02008153    ABLF02008462    ABLF02008464    GEDC01000337    JAS36961.1    GFXV01000774    MBW12579.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF10551   MULE
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.0174698,     Score=89

Ontologies

Topology

Length:
385
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.35609
Exp number, first 60 AAs:
0.00111
Total prob of N-in:
0.01529
outside
1  -  385
 
 

Population Genetic Test Statistics

Pi
31.712545
Theta
26.113038
Tajima's D
3.839414
CLR
0.569585
CSRT
0.997600119994
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号