SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16135
Pre Gene Modal
BGIBMGA004530
Annotation
endonuclease_and_reverse_transcriptase-like_protein_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 4.535
 

Sequence

CDS
ATGGCGTCGATAAACAGCTGCGGGGAATTGAAGAGTCCCGGGGACCCAGAGAAAAAGATCCCGGATACCGACGCTGAGAAACAACCGCTTTCCGGGAAAAAAGAAGAAAAATGGTGGACCACATTGATGCAGGTAGCTGTACCCTTCTTTATAGCTGGCTGCGGTACCATCGGAGCTGGTTTGGTGCTCGGCACAGTTAGGGATTGGGATGTTTTTATAAACATATCGGCCATTTTCGTTCTTGTGCCCTCACTGTCAGGACTAAAGGGTAACCTGGACATGTGTCTCGCATCTCGACTGTCAACGCAGGCGAATTTGGGCAACATGGACTCCACGAAGGAGGTCATCTCGATGGTCGTTGGAAACATATCATTGGTTCAGGTTCAAGCTATAGTGGCTGCGACTGTGGTCTCTATATTCGCCATCGTGGTGAACACGATCACGGACCGCGCCATCTTCGGGCCCTACGTCCTCCTGCTAGTCGCGTGCGCCGTCTTCACTGCTACGACCACTTGCTTTGTGTTGGATTTCGTGATGGTAATGGTGATATACGCGTCGCACAGGTTCAAGGTGAACCCGGACAACGTGGCGACTCCGCTGGCGGCCTCCATCGGGGACATCGTCAGCAATACGGTGCTAGCGGTCACCGCCCAGTACATGTACGAGCAGATCCAGGTGTCTCTGTGGCAGCCCATCGCGTTGATCTGCGTGTACTACAGCCTCCTCCCGCTCTGGGTGTTCATCGTCTGGAGGAACAAGTACACCAAGACCGTCCTCACCAGCGGCTGGACCCCCGTCATCTCCGCCCTGTTCATAAGCGGTATCGGCGGTATAGTCCTGGACCAGGCCGTCGATTACTTCCGAGGGTACGAGGTGTTCCAGCCGATCGTGAATGGAATCGGGGGGAACCTGGTGTGCGTGCAGTCGTCCCGGCTGGCCACGCACCTCCACCAGACCGCCATCCCCGGGATCCTGCCGGAGAACACTAAGATCATTGAGTGGCCTTGGAAGACTTTGTTCTTTGGAACGACCGCGGCGAACGTGGCTCGCATGCTGCTGATCCTGGCCGTCTTCGGGCAGATAATCTTCATGGTGGTCGCGGACTTCGTGTACCAGGGGACGGTCACCATCCAGTTCGCGTTCGGCATCACGTACCTCACGTGCGCCCTGCTGCAGTTAAATTCTCTGGAACATCTATATATTAATATGTTCTGCTTTTCCTCTGCTGATCCTGACGTCTGTGCGGACCGTCTTAAAGACGTGGTGCTCCAGGGGATGGAATTGTTTATTCCCTCCTCTGAAGTGCCCGTTGGAGGTCGCAGCAGACCCTGGTATAACAATGCCAGCAGGGATGCTGCACACCTCAAGCGGTCCGCATACGTGGCATGGGATAATGCCAGGAGACGTCAGGACCCTAACATCTCAGAGGAAAGGCGGAAATATAACGCCGCTTCCAGGTCCTACAAGAAGGTTATTGCCAAGGCGAAGTCGGAGCACGTTGCTAGAGTTGGCGAGCGACTAAAGAGCTATCCCTCTGGGAGCCGTGCTTTTTGGTCGCTCGCCAAAGCCGCAGAAGGAAACTTTTGCAGGTCTAGTCTCCCACCACTGCGAAAGTCCGATGACAGTCTGGCCCATAGTGCGAAAGAGAAGGCTGACCTTCTGGTCAAACTCTTCGCCTCGAACTCGACCGTGGACGACGGGGGTGCTACACCACCGAACATCCCCCGGTGTGATAGTTCCCTGCCGGAGATCTGCTTTACACAGTGTGCAGTCAGGCGGGAACTCCGACTCCTGGACGTCCATAAGTCGAGTGGGCCAGACGGCATCCCCGCAGTGGTTCTGAAAACGTGCGCCCCTGAGCTGACGCCTGCGCTAACGCGTCTGTATCGCCTCTCTTATTGCGCTAACAGGGTTCCGTCTTCATGGAAGACCGCCCATGTCCACCCTATCCCCAAGAAGGGTGACCGGTCGGACCCATCGAGCTATAGGCCTATCGCGATAACTTCCTTGCTTTCCAAGGTGATGGAGCGAATAATAAATATACAACTCCTGAAGTATCTTGAAGATCGCCAGCTGATCAGTGACCGACAGTACGGTTTCCGTCACGGTCGCTCAGCTGGCGATCTTCTCGTATACCTTACTCACAGGTGGGCTGAAGCCTTGGAGAGCAAGGGCGAGGCTCTTGCTGTGAGCCTTGATATCGCGAAGGCCTTCGACAGGGTCTGGCATAGGGCACTTCTGTCGAAGCTACCATCTTACGGAATCCCCGAGGGTCTCTGCAAGTGGATCGCTAGCTTTTTGGATGGGCGGAGCATCACGGTCGTTGTAGACGGTGATTGCTCTGATACCATGACCATTAACGCTGGCGTTCCACAAGGTTCGGTGCTCTCCCCCACGCTTTTCATCCTGTATATCAATGACATGCTGTCAATTGATGGCATGCATTGCTATGCGGATGACAGCACGGGGGATGCGCGATATATCGGCCATCAGAGTCTCTCTCGGAGCGTGGTGCAGGAGAGACGAACAAAACTTGTGTCTGAAGTGGAGAACTCTCTGGGGCGAGTCTCCAAATGGGGTGAATTGAACTTGATTCAATTCAACCCGTTAAAGACACAAATTTGCGCGTTCACTGCGAAGAAGGACCCCTTTGTCATGGCGCCGCAATTCCAAGGAGTATCCCTGCAACCTTCCGAGAGTATTGGGATACTTGGGGTCGACATTTCGAGCGATGTCCAGTTTCGGAGTCATCTGGAAGGCAAAGCCAAGTTGGCGTCCAAAATGCTGGGAGTCCTCAACAGAGCGAAGCGGTACTTCACGCCTGGACAAAGGCTTTTGCTTTATAAAGCACAAGTCCGGCCTCGCGTGGAGTACTGCTCCCATCTCTGGGCCGGGGCTCCCAAATACCAGCTTCTTCCATTTGACTCCATACAGAGGAGGGCCGTTCGGATTGTCGATAATCCCATTCTCACGGATCGTTTGGAGCCTCTGGGTCTGCGGAGGGACTTCGGTTCCCTCTGCATTTTGTACCGTATGTTCCATGGGGAGTGCTCTGAGGAATTGTTCGAGATGATACCGGCATCTCGTTTTTACCATCGCACCGCCCGCCACCGGAGTAGAGTTCATCCATACTACCTGGAGCCACTGCGGTCATCCACAGTGCGTTTCCAGAGGTCTTTTTTGCCACGTACCATCCGTCTATGGAATGAGCTCCCCTCCACGGTGTTTCCCGAGCGCTATGACATGTCCTTCTTCAAACGAGGCTTGTGGAGAGTATTAAACGGTAGGCAGCGGCTTGGCTCTGTCCCTGGCATTGCTGAAGTGATGCTGCTCCTTTACCTGGCCTACATCGTGATCCACTTCATGTGGAAGAGGAAGAAGGACCCCGACAATGCCGCCATCCCCTACCTCACGGCGCTCGGAGACCTCCTCGGCTCCGTGTTCCTGGGACTCGCCTTCGTCATCCTGTCCCTCTTCGGACTGGAATACGGCAATAATGTCCAGTGA
Protein
MASINSCGELKSPGDPEKKIPDTDAEKQPLSGKKEEKWWTTLMQVAVPFFIAGCGTIGAGLVLGTVRDWDVFINISAIFVLVPSLSGLKGNLDMCLASRLSTQANLGNMDSTKEVISMVVGNISLVQVQAIVAATVVSIFAIVVNTITDRAIFGPYVLLLVACAVFTATTTCFVLDFVMVMVIYASHRFKVNPDNVATPLAASIGDIVSNTVLAVTAQYMYEQIQVSLWQPIALICVYYSLLPLWVFIVWRNKYTKTVLTSGWTPVISALFISGIGGIVLDQAVDYFRGYEVFQPIVNGIGGNLVCVQSSRLATHLHQTAIPGILPENTKIIEWPWKTLFFGTTAANVARMLLILAVFGQIIFMVVADFVYQGTVTIQFAFGITYLTCALLQLNSLEHLYINMFCFSSADPDVCADRLKDVVLQGMELFIPSSEVPVGGRSRPWYNNASRDAAHLKRSAYVAWDNARRRQDPNISEERRKYNAASRSYKKVIAKAKSEHVARVGERLKSYPSGSRAFWSLAKAAEGNFCRSSLPPLRKSDDSLAHSAKEKADLLVKLFASNSTVDDGGATPPNIPRCDSSLPEICFTQCAVRRELRLLDVHKSSGPDGIPAVVLKTCAPELTPALTRLYRLSYCANRVPSSWKTAHVHPIPKKGDRSDPSSYRPIAITSLLSKVMERIINIQLLKYLEDRQLISDRQYGFRHGRSAGDLLVYLTHRWAEALESKGEALAVSLDIAKAFDRVWHRALLSKLPSYGIPEGLCKWIASFLDGRSITVVVDGDCSDTMTINAGVPQGSVLSPTLFILYINDMLSIDGMHCYADDSTGDARYIGHQSLSRSVVQERRTKLVSEVENSLGRVSKWGELNLIQFNPLKTQICAFTAKKDPFVMAPQFQGVSLQPSESIGILGVDISSDVQFRSHLEGKAKLASKMLGVLNRAKRYFTPGQRLLLYKAQVRPRVEYCSHLWAGAPKYQLLPFDSIQRRAVRIVDNPILTDRLEPLGLRRDFGSLCILYRMFHGECSEELFEMIPASRFYHRTARHRSRVHPYYLEPLRSSTVRFQRSFLPRTIRLWNELPSTVFPERYDMSFFKRGLWRVLNGRQRLGSVPGIAEVMLLLYLAYIVIHFMWKRKKDPDNAAIPYLTALGDLLGSVFLGLAFVILSLFGLEYGNNVQ

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=6.49747e-06,     Score=124

Ontologies

Topology

Length:
1168
Number of predicted TMHs:
10
Exp number of AAs in TMHs:
222.430870000001
Exp number, first 60 AAs:
18.28795
Total prob of N-in:
0.03755
POSSIBLE N-term signal
sequence
outside
1  -  41
TMhelix
42  -  64
inside
65  -  70
TMhelix
71  -  88
outside
89  -  122
TMhelix
123  -  145
inside
146  -  157
TMhelix
158  -  180
outside
181  -  227
TMhelix
228  -  250
inside
251  -  256
TMhelix
257  -  279
outside
280  -  347
TMhelix
348  -  370
inside
371  -  376
TMhelix
377  -  396
outside
397  -  1098
TMhelix
1099  -  1121
inside
1122  -  1133
TMhelix
1134  -  1156
outside
1157  -  1168
 
 

Population Genetic Test Statistics

Pi
230.089247
Theta
159.477442
Tajima's D
2.115105
CLR
0.15567
CSRT
0.900304984750762
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号