SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16134
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Amyelois_transitella]
Full name
Guanylate cyclase      
Location in the cell
PlasmaMembrane   Reliability : 1.656
 

Sequence

CDS
ATGTCACGGGGTAAGTCTCCGGGTCATGACGAGCTAAGCATAGAACACCTAAAGTATGCCGGTGTACACTTGCCCCGAGTCTTGGTTATGTTCTACAATTTATGTATAGGACACTCCTACTTGCCTGAGGAGATGTTGAAGACTGTGGTAGTGCCAATTGTGAAGAATAGGACCGGGGATATATGTGATAAAACCAATTACAGACCCATCTCGTTAGCAACTATCATAGCGAAAGTGCTTGACAGTTTGCTTAACATACAACTTGATAAATATCTTCAGATACATGATAACCAGTTTGGTTTTAAATCAGGAATGTCTACAGAAATAGCCGTATTGTGTTTAAAGCAAACTGTCAAGTACTATACTGATCGAAAAACTCCAATTTTTGCCTGTTTCCTCGATTTATCAAAGGCATTCGACTTGGTTTGTTATGACATCTTATGGCAAAAACTGAATAATACTAAAATGCCGAAAGAACTAGTACAGATATTCAAATATTGGTACGCCAACCAGCTGAACGTGGTACGATGGTCGGGTGTCTATTCGAGGCCATACGGGATGGAGTGCGGGGTGAGGCAAGGAGGGTTGACCTCGCCCAAGCTCTTCAACCTGTATGTGAATGCTCTAATCGAGGAGCTCAGCAGTACTCATGTCGGCTGCCATATTGATGAAATATGTCTCAACAATATCAGTTATGCTGATGACATGGTGCTGCTGAGTGCGTCGGCCTGTGGGCTGTCTAAGCTGCTTGGCATATGTGAAAGGTATGCTCTAAGTCACGGTCTAGTGTATAATACAAAGAAAAGTGAGTGTATGGTGTTTCAGGCCAGAGGCAGGTGTCTGGATAACATTCCCTCCGTCAAACTGAATGGTACGCCACTGCGCAGAGTAGACAAGTTTAAATACCTAGGACACTTTGTAACCTCTGACCTGAGGGATGATACAGACATTGAGCGGGAGCGGAGAGCGCTGTCTGTAAGAGCTAATATGATTGCCCGCAGGTTCGCTCGGTGTTCGCGGGATGTCAAAATCACTCTATTTAGAGCGTTTTGTACGTCCTTCTATACGTGCAGCCTGTGGGTGTTCTATAGTCAAAAGCAGTACAGCGCCTTACGCGTCCAATACAACAATGCGTTCAGGGTGTTGTTGGGGCTGCCTCGGTTCTGTAGCGCGTCGGGAATGTTCGCCGAGGCACGAGTCGACTGTTTCTTTACGACCATGCGGAAAAGATGCACATCCCTGATTGGCCGGGTCCGGGTCAGCCCTAACAACATCCTGAAGGCATTAACAGACCGTTATGACTGTCGGTACTTGAACCATTGTACCATGGTTCACTTGCAGGCTAAATAA
Protein
MSRGKSPGHDELSIEHLKYAGVHLPRVLVMFYNLCIGHSYLPEEMLKTVVVPIVKNRTGDICDKTNYRPISLATIIAKVLDSLLNIQLDKYLQIHDNQFGFKSGMSTEIAVLCLKQTVKYYTDRKTPIFACFLDLSKAFDLVCYDILWQKLNNTKMPKELVQIFKYWYANQLNVVRWSGVYSRPYGMECGVRQGGLTSPKLFNLYVNALIEELSSTHVGCHIDEICLNNISYADDMVLLSASACGLSKLLGICERYALSHGLVYNTKKSECMVFQARGRCLDNIPSVKLNGTPLRRVDKFKYLGHFVTSDLRDDTDIERERRALSVRANMIARRFARCSRDVKITLFRAFCTSFYTCSLWVFYSQKQYSALRVQYNNAFRVLLGLPRFCSASGMFAEARVDCFFTTMRKRCTSLIGRVRVSPNNILKALTDRYDCRYLNHCTMVHLQAK

Summary

Catalytic Activity
GTP = 3',5'-cyclic GMP + diphosphate
EC Number
4.6.1.2
EMBL
KZ150185    PZC72467.1    NWSH01000012    PCG80896.1    KZ150039    PZC74591.1    + More
KZ149940    PZC76937.1    NHMN01024349    PZC87407.1    RSAL01000132    RVE46368.1    KZ150122    PZC73158.1    RSAL01004459    RVE40147.1    GAIX01014011    JAA78549.1    ODYU01007038    SOQ49431.1    KZ150625    PZC70440.1    HAEJ01003895    SBS44352.1    GCES01119762    JAQ66560.1    GCES01120657    JAQ65665.1    GCES01122004    JAQ64318.1    GCES01018090    JAR68233.1    GCES01147931    JAQ38391.1    GCES01120011    JAQ66311.1    DMQF01000507    HAO15811.1    GDRN01099830    JAI58698.1    DMQF01000358    HAO15222.1    AAGJ04127121    AAGJ04127122    AAGJ04127123    GEZM01043747    JAV78865.1    GEZM01043993    JAV78596.1    DMQF01000476    HAO15703.1    GEZM01094272    GEZM01094271    JAV55745.1    GEZM01043748    JAV78864.1    GU815089    ADF18552.1    KZ150025    PZC74827.1    FJ265548    ADI61816.1    JARK01001348    EYC25145.1    FJ265563    ADI61831.1    REGN01000623    RNA40614.1    AAGJ04058037    GEZM01094174    JAV55841.1    REGN01007025    RNA07484.1    GEZM01094173    JAV55843.1    GDRN01086563    JAI61160.1    MPRK01000277    OOZ37539.1    GBHO01042545    GBRD01013465    JAG01059.1    JAG52361.1    GDHC01021277    JAP97351.1    GBHO01021345    JAG22259.1    JARK01001500    JARK01001343    EYB95040.1    EYC28825.1    FJ265553    ADI61821.1    FJ265560    ADI61828.1    FJ265552    ADI61820.1    JARK01001424    EYC04315.1    EYC04316.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF12832   MFS_1_like
PF03372   Exo_endo_phos
PF01094   ANF_receptor
PF07714   Pkinase_Tyr
PF00211   Guanylate_cyc
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR000477   RT_dom       
IPR024989   MFS_assoc_dom       
IPR005135   Endo/exonuclease/phosphatase       
IPR036259   MFS_trans_sf       
IPR020846   MFS_dom       
IPR013087   Znf_C2H2_type       
IPR002138   Pept_C14_p10       
IPR001828   ANF_lig-bd_rcpt       
IPR001245   Ser-Thr/Tyr_kinase_cat_dom       
IPR011009   Kinase-like_dom_sf       
IPR001170   ANPR/GUC       
IPR001054   A/G_cyclase       
IPR028082   Peripla_BP_I       
IPR000719   Prot_kinase_dom       
IPR029787   Nucleotide_cyclase       
SUPFAM
SSF56219   SSF56219        + More
SSF103473   SSF103473       
SSF53822   SSF53822       
SSF55073   SSF55073       
SSF56112   SSF56112       
Gene 3D
PDB
5HHL     E-value=0.000510793,     Score=103

Ontologies

Topology

Length:
449
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
10.96234
Exp number, first 60 AAs:
0.70511
Total prob of N-in:
0.09721
outside
1  -  449
 
 

Population Genetic Test Statistics

Pi
156.240755
Theta
82.156061
Tajima's D
2.156058
CLR
0
CSRT
0.901654917254137
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号