SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16133
Pre Gene Modal
BGIBMGA014493
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_uncharacterized_protein_LOC105841899?_partial_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.016
 

Sequence

CDS
ATGATGCAGATCAGAATACTAGTAGTGGTACGCCACAAGAGCGTGAATGCAGCATACGTAGCCGGAGGTGAGACTTCCGCGGTCGCGGCCCACCCAGTCCGCGAGAACCGGGCAGATCGCCTCGACGGTACGGAGGCCGGCCGACGGGTCCGCCAAACGACGAGACCTCGCCTCCAGCACGGACTGCCGATATTGGAGCCCCCGCGCTCCGGATGCACTTGCGCTAGGGCGCGCCGCCTCGTAGGAGACTGTGAGGCTCGAGCTGCTACTTGCCTCACAAAAATACAGCCTGCAAAACCTGAACAACCTCCTCATCCGTGGGCGCCCGGCTCTCGCCTGCAAGTCGGCTGTTACGTGTGCGGTGATGCGAGCCATGTAGCTTCTGGGTGTTCCATGCGCTACAAGAAGAAAAACGACACTGCTCCAGGTGCTGTGGCAGGTTCAACCAGAGACGTCAACGATACATATCGACCGGAGCAGTACGGCTTCAGAGAGGGCCGCTCGACTATCGACGCGATTCTGCGCGTGAGGGCCCTCTCCGACGAAGCCGTATCCCGGGGCGGGGTGGCGATGGCGTTATCCTTAGATGTAAGGAACGCCTTCAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGGAGTATCACGGCGTCCCCGCATACCTCCGCCGACTGATCGGCTCCTACCTCGAGGGCAGGTCGATCCAGTGCATCGGACACGGTGGGGCGATGTACCGCTTCCCCGTCGAGCGCGGTGTTCCGCAGGGGTCCGTCCTGGGCCCCCTGCTGTGGAACATCGGCTACGACTGGGTCCTGCGGGGCGTCATTCGGGGACCCCTCCCCGGGCTCAGCGTAATTTGTTACGCTGACGACACGTTGGTCGTGGCTCCGGGGAGGGACTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACACGTCGTCACTAGGATCCGACGGTTGGGGCTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGCTCTTTCACGGGCCGGGACGAGCGCCGCCTGTGGGTGCCCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTACCTCGGCCTCGAACTGGACGGTCGGTGGAACTTCCGCGCTCACTTTGAGAAGTTGGGCCCTCGGCTGATGGCAACGGCCGGCTCTTTGAGCCGGCTCCTTCCAAACGTCGGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATAGCACTATACGGCGCTCCCGTATGGTGCCACGCCCTGACCCGCGAGAACGTCGCCGCGCTGCGACGTCCACAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGACCTCCGCTCTAGGGGGGAAGGGCGCCCCGGCGAAGGAGTAGTTCGAGCGCGGAGGCTCCAATCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGTACCGTCGAGGCGGTCCGTCCGGTCCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTGACGCAAATGTTGACCGGCCATGGTTGTTTTGGCCGGTACTTGCACAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCATCACTGCGCGGACCGCGACGAGGATGACACAGCGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATAGGTGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGTACGTCCCGGCCCCTGTAG
Protein
MMQIRILVVVRHKSVNAAYVAGGETSAVAAHPVRENRADRLDGTEAGRRVRQTTRPRLQHGLPILEPPRSGCTCARARRLVGDCEARAATCLTKIQPAKPEQPPHPWAPGSRLQVGCYVCGDASHVASGCSMRYKKKNDTAPGAVAGSTRDVNDTYRPEQYGFREGRSTIDAILRVRALSDEAVSRGGVAMALSLDVRNAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEGRSIQCIGHGGAMYRFPVERGVPQGSVLGPLLWNIGYDWVLRGVIRGPLPGLSVICYADDTLVVAPGRDYRESARLACAGVAHVVTRIRRLGLEVALDKTQALLFHGPGRAPPVGAHLVIGGVRVGVGVTGLRYLGLELDGRWNFRAHFEKLGPRLMATAGSLSRLLPNVGGPDQVARRLYMGVVRSIALYGAPVWCHALTRENVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPGEGVVRARRLQSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLHKIAGREPTAQCHHCADRDEDDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPL

Summary

EMBL
AB090825    BAC57926.1    AB078935    BAC06462.1    AB078931    BAC06456.1    + More
AB078930    BAC06454.1    AB078929    BAC06452.1    LBMM01012027    KMQ86470.1    RSAL01000481    RVE41577.1    KZ149896    PZC78733.1    D85594    BAA19776.1    KQ460685    KPJ12887.1    LBMM01019839    KMQ83438.1    LBMM01019838    KMQ83439.1    LBMM01006954    KMQ90166.1    LBMM01006671    KMQ90407.1    LBMM01004272    KMQ92618.1    LBMM01006725    KMQ90373.1    LBMM01006657    KMQ90417.1    LBMM01005733    KMQ91252.1    LBMM01003245    KMQ93755.1    LBMM01007036    KMQ90099.1    LBMM01004505    KMQ92346.1    LBMM01015018    KMQ84954.1    LBMM01015025    KMQ84953.1    LBMM01004634    KMQ92224.1    LBMM01005216    KMQ91703.1    LBMM01005948    KMQ91066.1    LBMM01003988    KMQ92922.1    LBMM01007425    KMQ89740.1    LBMM01002052    KMQ95336.1    LBMM01014956    KMQ84982.1    LBMM01008682    KMQ88705.1    LBMM01002480    KMQ94776.1    KMQ94772.1    LBMM01012412    KMQ86235.1    LBMM01008278    KMQ89009.1    LBMM01005465    KMQ91492.1    LBMM01008422    KMQ88894.1    LBMM01014122    KMQ85315.1    LBMM01005474    KMQ91485.1    GGMR01014195    MBY26814.1    GGMR01015159    MBY27778.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    ABLF02011238    ABLF02041886    LBMM01006110    KMQ90925.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    KU543683    AMS38371.1    GFXV01003903    MBW15708.1    ABLF02041323    ABLF02041325    AJ278684    CAB99192.1    ABLF02009991    ABLF02009992    ABLF02054952    KQ971309    EEZ99146.1    GAMC01020517    JAB86038.1    GAMC01020519    GAMC01020515    JAB86040.1    AB593323    BAK38643.1    KQ972544    KXZ75870.1    AB593321    BAK38639.1    ABLF02059310    GGFM01001554    MBW22305.1    KQ972691    KXZ75806.1    AB593326    BAK38647.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07776   zf-AD
PF00096   zf-C2H2
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
680
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.18504
Exp number, first 60 AAs:
0.01419
Total prob of N-in:
0.00216
outside
1  -  680
 
 

Population Genetic Test Statistics

Pi
186.936383
Theta
58.534877
Tajima's D
1.869283
CLR
0.286795
CSRT
0.860956952152392
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号