SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16124
Pre Gene Modal
BGIBMGA008012
Annotation
PREDICTED:_tigger_transposable_element-derived_protein_4-like_[Papilio_machaon]
Full name
Tigger transposable element-derived protein 4      
Location in the cell
Nuclear   Reliability : 3.413
 

Sequence

CDS
ATGAAACGAGCCAGAACAACGAAGCACACGAATATTGAGGAAGCTTTGTTGAAGTGGTTTAAATGTCAAAGGGCTAATAATGTGCCAATAAACGGACCGATTCTTCAAGAAAAAGCTAACGATTTTGCTCAACGTTTTGGCGAAGATTTTGTTTGCTCGTCTAGTTGGATCCAACGTTTCCGGGCTCGGCACGGTATTATCGGCGGGAAAATGAGTGGTGAAGCTGCCAGTGTTGATAAGGATACTGTAGAAGAATGGATAACGCAAAAGTGGCCTACATTATTCGAAGGCTACGGACCAGATGAAATTTTTAACGCAGACGAAACTGGACTTTTTTACAATATGACACCGGACAAGACTTTAAAGTTCAAAGGAGAGAATTGTTCGGGAGGAAAAATGTCTAAGACAAGATTAACGATCATGGTTGCAGCAAATATGACAGGATCCTCTAAAAGAAAGCTTTTAGTTATTGGCAAATCTAAGAAACCAAGATGCTTTAAAAACATACACTCACTGCCGGTAACGTATGAAAACAATGTGAAGTCATGGATGACATCGGACATTTTTGAGAGATGGTTAAGAAACTGGGACGCTGAATTGAAAGGAAACAAACAGAAAGTTCTACTTTTGGTTGATAACTGTCCTGCTCATCCGGCTGTTACTAATCTAAAATGCATTAAACTTGTGTTCTTACCACCAAATGTTACATCTGTATTGCAACTAATGGAGCAAGGTGTCATAAGATGTTTAAAATCTCACTATAGAAGACTGCAAGTGTTAAAGTTAATACAAAATCTTGACAGTAGCGAACAAAAAAGGTTTACGGTTCTTGATGCCATCTTAATGATATCAGAAGCATGGAAAAACGTTTCACAAAACACTATAGCTAACTGCTTTAAGCATGCTGGTTTTAAAGACCTCTTAACAATAACCTCAGATGATGTGACTGATGATGATGGAGAGGACAATATTTCTCTTGCTCAATTAGCCCAAAATGTACGACCTGCTTTATATACTACTGAAGCAGCAGAGTTCATTGATGTAGATAACTCTATTGCAATTTGCGCACGAGCTACGGAATATGATATTGTACGAGATGTTCAAGAGGAAGATGACGAACAGGAAGACTCTGAAGAACAATTTACTGTACCAACTTTGAATGATGGTATCAATGCTGTTAGTATATTAAGAAAGATTGTTCTTTTTAATGAACATTTCCACATCCACAGCAATTATGACGATACGTTAATTAAAATCCAACGTGAATTACAAAATATCTATGCACAACAGAAGTGTTCCAAACAGACCAAAATTAGAGATTTTATGCTTACAGAAAAATAA
Protein
MKRARTTKHTNIEEALLKWFKCQRANNVPINGPILQEKANDFAQRFGEDFVCSSSWIQRFRARHGIIGGKMSGEAASVDKDTVEEWITQKWPTLFEGYGPDEIFNADETGLFYNMTPDKTLKFKGENCSGGKMSKTRLTIMVAANMTGSSKRKLLVIGKSKKPRCFKNIHSLPVTYENNVKSWMTSDIFERWLRNWDAELKGNKQKVLLLVDNCPAHPAVTNLKCIKLVFLPPNVTSVLQLMEQGVIRCLKSHYRRLQVLKLIQNLDSSEQKRFTVLDAILMISEAWKNVSQNTIANCFKHAGFKDLLTITSDDVTDDDGEDNISLAQLAQNVRPALYTTEAAEFIDVDNSIAICARATEYDIVRDVQEEDDEQEDSEEQFTVPTLNDGINAVSILRKIVLFNEHFHIHSNYDDTLIKIQRELQNIYAQQKCSKQTKIRDFMLTEK

Summary

Similarity
Belongs to the tigger transposable element derived protein family.
Keywords
Complete proteome   DNA-binding   Nucleus   Polymorphism   Reference proteome  
Feature
chain  Tigger transposable element-derived protein 4
sequence variant  In dbSNP:rs34432931.
EMBL
BABH01023425    BABH01031799    GALX01001744    JAB66722.1    ODYU01005364    SOQ46128.1    + More
CH933812    KRG07157.1    GEZM01080219    GEZM01080218    JAV62288.1    GGMR01008478    MBY21097.1    GFAA01002355    JAU01080.1    NEVH01021236    PNF19682.1    GGLE01001733    MBY05859.1    GFAA01000830    JAU02605.1    ABLF02034653    AKHW03003207    KYO35178.1    IAAA01026926    LAA07859.1    GEFH01002147    JAP66434.1    GBBK01002531    JAC21951.1    KK118338    KFM72755.1    KK120216    KFM77786.1    GFAC01005197    JAT93991.1    GACK01000229    JAA64805.1    KK120140    KFM77611.1    GACK01000230    JAA64804.1    GBBM01000897    JAC34521.1    GGLE01004497    MBY08623.1    KK117753    KFM71335.1    GACK01000074    JAA64960.1    LJIJ01003184    ODM88784.1    HACG01049168    HACG01049169    HACG01049170    HACG01049171    CEK96033.1    CEK96034.1    CEK96035.1    CEK96036.1    GFAA01001803    JAU01632.1    AAEX03010049    HAAF01000614    CCP72440.1    AEYP01045400    ABLF02042388    ACTA01040196    GL192370    EFB26546.1    CYRY02045419    VCX40834.1    KB017510    EPY77151.1    AEFK01215205    GEGO01004591    JAR90813.1    AAQR03075137    KK492952    KFQ64083.1    JH882892    ELR47958.1    KL483028    KFO08644.1    GACK01000607    JAA64427.1    AC106882    BC037869    AK058054    AMGL01037157   
Pfam
PF03221   HTH_Tnp_Tc5        + More
PF03184   DDE_1
PF04218   CENP-B_N
PF01388   ARID
Interpro
IPR004875   DDE_SF_endonuclease_dom        + More
IPR006600   HTH_CenpB_DNA-bd_dom       
IPR007889   HTH_Psq       
IPR009057   Homeobox-like_sf       
IPR036431   ARID_dom_sf       
IPR001606   ARID_dom       
IPR036388   WH-like_DNA-bd_sf       
SUPFAM
SSF46689   SSF46689        + More
SSF46774   SSF46774       
Gene 3D
PDB
1HLV     E-value=1.30126e-05,     Score=117

Ontologies

Topology

Subcellular location
Nucleus  
Length:
446
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02019
Exp number, first 60 AAs:
0
Total prob of N-in:
0.10975
outside
1  -  446
 
 

Population Genetic Test Statistics

Pi
27.752561
Theta
38.56581
Tajima's D
-1.002237
CLR
40.641811
CSRT
0.139143042847858
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号