SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16090  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA014536
Annotation
heat_shock_protein_70_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 2.707
 

Sequence

CDS
ATGCCAGCTATCGGAATCGATTTGGGAACGACATACTCATGTGTTGGAGTATGGCAGCACGGGAACGTGGAGATCATCGCGAACGACCAGGGCAACCGTACCACACCATCGTACGTCGCGTTCACGGACACGGAGCGTCTCATCGGCGACGCAGCCAAGAACCAGGTCGCCTTGAACCCTAACAACACCGTGTTCGACGCGAAGAGGCTGATCGGGAGGAAATTCGATGACCCCAAGATTCAGCAGGACATGAAGCACTGGCCCTTCAAAGTGATCAACGACTGCGGCAAACCGAAAATACAGATCGAGTTCAAAGGTGAGACGAAACGATTTGCGCCAGAAGAAATTAGCAGCATGGTGCTGACAAAAATGAAGGAGACGGCGGAAGCGTATCTGGGAAGCACAGTGCGGGATGCGGTAGTCACAGTTCCGGCATACTTCAACGACTCCCAGCGTCAGGCCACCAAGGACGCCGGAGCCATCGCCGGCCTGAACGTACTCCGCATCATCAACGAGCCCACAGCCGCCGCGCTCGCGTACGGCCTCGACAAGAACCTCAAGGGCGAGAGAAATGTTCTTATCTTCGATCTGGGTGGAGGAACCTTCGACGTGTCCGTCCTGACCATCGACGAGGGATCGTTGTTCGAAGTGAAGTCCACAGCCGGCGACACGCACCTGGGAGGCGAGGACTTCGATAACCGACTAGTCAACCATCTTGCGGAAGAGTTCAAGCGCAAGTACAAGAAGGATCTGCGCCTGAACTCTCGCGCACTCCGACGCCTCCGCACGGCTGCTGAGCGCGCCAAGAGGACACTCTCATCCAGCACCGAAGCCACCATTGAGATTGACGCTCTGTATGAGGGCATCGACTTCTACACGCGAGTCTCCCGCGCCCGCTTCGAGGAACTGAACGCGGACCTGTTCAGGGGAACTCTGGAACCCGTCGAGAAGGCACTCAAGGATGCTAAACTCGACAAGAGTCAGATCCACGACGTGGTCCTCGTCGGAGGCTCCACCCGCATTCCGAAAGTACAGACTATGCTTCAAAACTTCTTCTGTGGAAAGAAACTGAACCTATCCATAAATCCGGACGAAGCCGTAGCCTACGGTGCAGCAGTCCAGGCGGCCATCCTGAGCGGCGAGACCGACTCCAAGATACAGGACGTCTTGTTGGTCGACGTGGCTCCTCTGTCTCTCGGTATTGAGACAGCTGGCGGCGTGATGACGAAGATCATCGAACGAAACTCGAAGATTCCGTGCAAACAGTCTCAGACATTCACGACGTACTCAGACAACCAGCCGGCCGTCACCATCCAGGTGTACGAGGGAGAGAGAGCGATGACAAAGGACAACAACCTTCTGGGCACGTTCGACCTGACAGGGATCCCGCCCGCGCCGCGAGGAGTGCCCAAGATCGACGTGACGTTCGACATGGACGCTAACGGCATCCTGAACGTGTCGGCCAAGGAGAACAGCACCGGCCGCAGCAAGAACATCGTGATCAAGAACGACAAGGGTCGTCTCTCGCAAGCGGAGATCGATCGCATGCTGTCCGAGGCAGAGCGGTACAAGGAGGAAGACGAGAAGCAGAGACAGCGCGTGGCCGCTCGGAACCAGCTCGAATCGTATTTGTTCAGCGTGAAGCAGGCGCTCGACGAGGCCGGCGACAAACTTAGCGACGCGGACAAGAGCACGGCGCGCGACGCGTGTGACGAGGCGCTGCGGTGGCTGGACAACAACACTCTCGCTGACCAGGATGAGTACGAGCACAAGCTGAAGGATGTGCAGCGAGTGTGTTCGCCGGTCATGAGCAAGATGCACGGTGCGGCGCCCGGCGGCATGCCAGGAGGAATGCCAGGAGGAATGCCGGGTGGCATGCCAGGTGGTATGCCGGGCGGTATGCCTGGATACATGCCTGGTGGAATGCCGGGTGGATACCAAATGCCACGAAATGATGGACCCACTGTCGAAGAAGTTGATTGA
Protein
MPAIGIDLGTTYSCVGVWQHGNVEIIANDQGNRTTPSYVAFTDTERLIGDAAKNQVALNPNNTVFDAKRLIGRKFDDPKIQQDMKHWPFKVINDCGKPKIQIEFKGETKRFAPEEISSMVLTKMKETAEAYLGSTVRDAVVTVPAYFNDSQRQATKDAGAIAGLNVLRIINEPTAAALAYGLDKNLKGERNVLIFDLGGGTFDVSVLTIDEGSLFEVKSTAGDTHLGGEDFDNRLVNHLAEEFKRKYKKDLRLNSRALRRLRTAAERAKRTLSSSTEATIEIDALYEGIDFYTRVSRARFEELNADLFRGTLEPVEKALKDAKLDKSQIHDVVLVGGSTRIPKVQTMLQNFFCGKKLNLSINPDEAVAYGAAVQAAILSGETDSKIQDVLLVDVAPLSLGIETAGGVMTKIIERNSKIPCKQSQTFTTYSDNQPAVTIQVYEGERAMTKDNNLLGTFDLTGIPPAPRGVPKIDVTFDMDANGILNVSAKENSTGRSKNIVIKNDKGRLSQAEIDRMLSEAERYKEEDEKQRQRVAARNQLESYLFSVKQALDEAGDKLSDADKSTARDACDEALRWLDNNTLADQDEYEHKLKDVQRVCSPVMSKMHGAAPGGMPGGMPGGMPGGMPGGMPGGMPGYMPGGMPGGYQMPRNDGPTVEEVD

Summary

Similarity
Belongs to the heat shock protein 70 family.
EMBL
JF836794    AEI58996.1    DQ311189    ABD36134.1    AB035326    BAF69068.1    + More
FJ862049    ACQ78180.1    FJ754276    ACN78407.1    KY930331    ATL76715.1    HQ012004    ADV03160.1    AB179657    BAD18974.1    AGBW02009614    OWR50325.1    JX680669    AGR84216.1    JX680670    AGR84217.1    ODYU01007205    SOQ49779.1    JX680677    AGR84224.1    KQ458671    KPJ05577.1    GU945198    KR821069    ADI50267.1    ALL42057.1    JX680676    AGR84223.1    GQ389711    ACV32640.1    HM593518    ADP37711.1    HM370511    ADK94699.1    AGBW02009136    OWR51575.1    JQ693014    AFQ37587.1    HM370510    ADK94698.1    KZ150133    PZC73022.1    JTDY01004123    KOB68565.1    HM370509    ADK94697.1    AB251895    BAF03555.1    KT225460    ALL42052.1    JX678981    AFU06382.1    GQ199477    ACS72236.1    EU430480    ABZ10939.1    JQ693015    AFQ37588.1    HQ107971    ADV58254.1    HQ107972    ADV58255.1    JQ711194    AFQ33498.1    BABH01042878    JF836795    AEI58997.1    AB325801    BAF95560.1    EF523381    ABP93405.1    AY220911    AAO65964.1    JN863694    AFK93489.2    JN863695    AFK93490.1    HM212645    ADK39311.1    KJ701421    AID61521.1    HM367079    ADO14473.1    JQ316541    AFO70209.1    DQ093385    ACZ52196.1    HM013709    ADG03465.1    EU934244    ACH85201.1    JX112893    AFP54305.1    GU074513    ACY71070.1    EU861391    ACF74975.2    EU934240    ACH85197.1    GBBI01002049    JAC16663.1    GBBI01002050    JAC16662.1    ACPB03005879    KY705385    ARW29611.1    APGK01039300    BT127689    KB740969    KB632230    AEE62651.1    ENN76739.1    ERL90378.1    EF569673    ABQ39970.1    MG265913    AXU24969.1    GEBQ01026193    JAT13784.1    KX695168    AQP31338.1    KU311038    AMQ77288.1    KT003964    ANJ86404.1    CH933806    EDW14253.1    GFTR01007568    JAW08858.1    MG265899    AXU24955.1    JF421286    AEB52075.1    KU159184    AMX23517.1    KQ971352    EFA07459.1    EFA07510.1    KF771049    AHG94986.1    KQ971354    EFA07173.1    MF773976    AXB26576.1    JX627810    AFX84560.1    HQ184405    ADX42270.1    KY705383    ARW29609.1    ABLF02040542    KY705384    ARW29610.1    KY661325    AVA17412.1    KC620440    AHE77387.1    HQ184404    ADX42267.1    KF018929    AGT99186.1    APGK01039299    ENN76738.1    ERL90377.1    ADX42268.1    KX976473    AQP31363.1    GEDC01012328    JAS24970.1    KQ460126    KPJ17595.1    DQ017057    AAY28732.1    AGBW02010783    OWR47855.1    ADX42269.1    KY231148    ARQ84028.1    AY842477    AAW32099.2    KU311037    AMQ77287.1    KF731995    AHF81959.1    NEVH01025635    PNF15343.1    KK853289    KDR08926.1    HM013712    ADG03468.1   
Pfam
PF00012   HSP70
Interpro
IPR018181   Heat_shock_70_CS        + More
IPR029048   HSP70_C_sf       
IPR013126   Hsp_70_fam       
IPR029047   HSP70_peptide-bd_sf       
SUPFAM
SSF100920   SSF100920        + More
SSF100934   SSF100934       
Gene 3D
PDB
5FPN     E-value=0,     Score=2207

Ontologies

Topology

Length:
660
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02726
Exp number, first 60 AAs:
0.00041
Total prob of N-in:
0.00022
outside
1  -  660
 
 

Population Genetic Test Statistics

Pi
538.134216
Theta
234.195461
Tajima's D
4.390242
CLR
0.136241
CSRT
0.999750012499375
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
20518026 MEELTRHCSPIMTK 95.24 4e-09
20518026 WLDSNTTAEK 95.24 4e-09
20518026 TTPSYVAFTDTER 100.00 5e-07
20518026 VQTMLQNFFCGK 100.00 8e-07
20518026 WLDNNTLADQDEYEHK 100.00 3e-06
20518026 GANKCFSPEEISSMVLTK 100.00 7e-06
20518026 FAPEEISSMVLTK 100.00 7e-06
20518026 SQIHDVVLVGGSTR 100.00 3e-05
20518026 STARDACDEALR 100.00 5e-05
20518026 FDDPKIQQDMK 100.00 2e-04
20518026 IINEPTAAALAYGLDK 100.00 3e-04
20518026 VINDNGKPK 100.00 3e-04
20518026 IINEPTAAALAYGLDK 100.00 3e-04
28556443 SLGIETAGGVMTTLIK 100.00 3e-04
28556443 SLGIETAGGVMTTLIK 100.00 3e-04
20518026 DAGAIAGLNVLR 100.00 5e-04
20518026 DAGAIAGINVLR 100.00 5e-04
20518026 FAPEEISSMVLTK 100.00 0.002
25044914 DAVTFIEK 100.00 0.002
20518026 TTPSYVAFTDTERLIGDAAK 100.00 0.002
20518026 GTLEPVEKALK 100.00 0.006
20518026 SQIHDVVLVGGSTRIPK 100.00 0.009
20518026 IQIEFK 100.00 0.012
20518026 IEDVGEDEDADK 100.00 0.046
31223520 ARFEELNADLFR 100.00 0.046
26822097 FEEINADIFR 100.00 0.046
26280517 MNFSHGSHEYHAETIR 100.00 0.046
25044914 TTPQIVIR 100.00 0.046
24093152 TTPAAADVEK 100.00 0.046
24402669 TTPQIVIR 100.00 0.046
27102218 VEIIANDQGNR 100.00 0.046
28467696 TTPSSQIEQIIPSYTEIK 100.00 0.046
29197581 YPGPIQDVGNR 100.00 0.046
28556443 TTPSYVAFTDTER 100.00 0.046
28556443 TTPSYVAFTDTER 100.00 0.046
28556443 TTPSYVAFTDTER 100.00 0.046
28556443 TIEDGIFEVK 100.00 0.046
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号