SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16088  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA014536
Annotation
heat_shock_protein_70_A1_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 2.445
 

Sequence

CDS
ATGCCAGCTATCGGAATCGATTTGGGAACGACATACTCATGTGTTGGAGTATGGCAGCACGGGAACGTGGAGATCATCGCGAACGACCAGGGCAACCGCACCACACCATCGTACGTCGCGTTCACGGACACGGAGCGTCTCATCGGCGACGCAGCCAAGAACCAGGTCGCCTTGAACCCTAACAACACCGTGTTCGACGCGAAGAGGCTGATCGGGAGGAAATTCGACGACCCCAAGATTCAGCAGGACATGAAGCACTGGCCCTTCAAAGTGATCAACGACTGCGGCAAACCGAAAATACAGATCGAGTTCAAAGGTGAGACGAAACGATTTGCGCCAGAAGAAATTAGCAGCATGGTGCTGACAAAAATGAAGGAGACGGCGGAAGCCTATCTGGGAAGTACAGTGCGGGATGCGGTAGTCACAGTTCCGGCATACTTCAACGACTCCCAGCGTCAGGCCACCAAGGACGCCGGAGCCATAGCCGGCCTGAACGTGCTTCGCATCATCAACGAGCCCACAGCCGCCGCGCTCGCGTACGGTCTCGACAAGAACCTCAAGGGTGAGAGAAATGTTCTTATCTTCGATCTGGGTGGAGGAACCTTCGACGTGTCCATCCTGACTATCGACGAGGGATCGTTGTTCGAAGTGAAGTCCACAGCCGGCGACACGCACCTGGGAGGCGAAGACTTTGATAACCGACTAGTCAACCATCTTGCGGAAGAGTTCAAGCGCAAGTACAAGAAGGATCTGCGCCTGAACTCTCGCGCACTCCGACGCCTCCGCACGGCCGCTGAGCGCGCCAAGAGGACACTCTCATCCAGCACCGAGGCCACCATCGAGATTGACGCTCTGTATGAGGGCATCGACTTCTACACGCGAGTCTCCCGCGCCCGCTTCGAGGAACTGAACGCGGACCTGTTCAGGGGAACTCTGGAACCCGTCGAGAAGGCACTCAAGGATGCTAAACTCGACAAGAGTCAGATCCACGACGTGGTCCTCGTCGGAGGCTCCACCCGCATTCCGAAAGTACAAACTATGCTCCAAAACTTCTTCTGTGGGAAGAAACTGAACCTATCCATCAATCCGGACGAAGCCGTAGCCTACGGTGCAGCAGTCCAGGCAGCCATCCTGAGCGGCGAGACCGACTCCAAGATACAGGACGTCTTGTTGGTCGACGTGGCTCCTCTGTCCCTCGGTATTGAGACAGCCGGCGGCGTGATGACGAAGATCATCGAACGAAACTCGAAGATTCCGTGCAAACAGTCTCAGACATTCACGACGTATTCAGACAATCAGCCGGCCGTCACCATCCAGGTGTACGAGGGAGAGAGAGCGATGACAAAGGACAACAACCTACTGGGCACGTTCGACCTGACGGGGATCCCGCCCGCGCCGCGAGGAGTGCCCAAGATCGACGTGACGTTCGACATGGACGCTAACGGCATCCTGAACGTGTCGGCCAAGGAGAACAGCACCGGCCGCAGCAAGAACATCGTGATCAAGAACGACAAGGGTCGTCTCTCGCAAGCGGAGATCGATCGCATGCTGTCCGAGGCAGAGCGGTACAAGGAGGAAGACGAGAAGCAGAGACAGCGCGTGGCCGCTCGGAACCAGCTCGAATCGTATTTGTTCAGCGTGAAGCAGGCGCTCGACGAGGCCGGCGACAAACTGAGCGACGCAGACAAGAGCACGGCGCGCGACGCGTGTGACGAGGCGCTGCGGTGGCTGGACAACAACACTCTCGCTGACCAGGATGAATACGAGCACAAGCTGAAGGATGTGCAGCGAGTGTGTTCGCCGGTCATGAGCAAGATGCACGGTGCGGCGCCCGGCGGTATGCCAGGAGGAATGCCGGGCGGTATGCCGGGAGGATACCAACAAGCGAGGAGTGATGGACCCACAGTTGAGGAAGTCGACTAA
Protein
MPAIGIDLGTTYSCVGVWQHGNVEIIANDQGNRTTPSYVAFTDTERLIGDAAKNQVALNPNNTVFDAKRLIGRKFDDPKIQQDMKHWPFKVINDCGKPKIQIEFKGETKRFAPEEISSMVLTKMKETAEAYLGSTVRDAVVTVPAYFNDSQRQATKDAGAIAGLNVLRIINEPTAAALAYGLDKNLKGERNVLIFDLGGGTFDVSILTIDEGSLFEVKSTAGDTHLGGEDFDNRLVNHLAEEFKRKYKKDLRLNSRALRRLRTAAERAKRTLSSSTEATIEIDALYEGIDFYTRVSRARFEELNADLFRGTLEPVEKALKDAKLDKSQIHDVVLVGGSTRIPKVQTMLQNFFCGKKLNLSINPDEAVAYGAAVQAAILSGETDSKIQDVLLVDVAPLSLGIETAGGVMTKIIERNSKIPCKQSQTFTTYSDNQPAVTIQVYEGERAMTKDNNLLGTFDLTGIPPAPRGVPKIDVTFDMDANGILNVSAKENSTGRSKNIVIKNDKGRLSQAEIDRMLSEAERYKEEDEKQRQRVAARNQLESYLFSVKQALDEAGDKLSDADKSTARDACDEALRWLDNNTLADQDEYEHKLKDVQRVCSPVMSKMHGAAPGGMPGGMPGGMPGGYQQARSDGPTVEEVD

Summary

Similarity
Belongs to the heat shock protein 70 family.
EMBL
JF836794    AEI58996.1    AB035326    BAF69068.1    DQ311189    ABD36134.1    + More
KY930331    ATL76715.1    FJ862049    ACQ78180.1    AB179657    BAD18974.1    FJ754276    ACN78407.1    JX680669    AGR84216.1    HQ012004    ADV03160.1    AGBW02009614    OWR50325.1    GU945198    KR821069    ADI50267.1    ALL42057.1    ODYU01007205    SOQ49779.1    KQ458671    KPJ05577.1    GQ389711    ACV32640.1    JX680670    AGR84217.1    HM593518    ADP37711.1    JX680677    AGR84224.1    JX680676    AGR84223.1    JTDY01004123    KOB68565.1    AGBW02009136    OWR51575.1    KZ150133    PZC73022.1    HM370511    ADK94699.1    JQ693014    AFQ37587.1    HM370510    ADK94698.1    GQ199477    ACS72236.1    AB251895    BAF03555.1    BABH01042878    JF836795    AEI58997.1    KT225460    ALL42052.1    EU430480    ABZ10939.1    HM370509    ADK94697.1    JX678981    AFU06382.1    EF523381    ABP93405.1    AY220911    AAO65964.1    JQ693015    AFQ37588.1    HQ107971    ADV58254.1    JQ711194    AFQ33498.1    HQ107972    ADV58255.1    AB325801    BAF95560.1    JN863694    AFK93489.2    JN863695    AFK93490.1    KJ701421    AID61521.1    JQ316541    AFO70209.1    HM212645    ADK39311.1    JX112893    AFP54305.1    HM367079    ADO14473.1    DQ093385    ACZ52196.1    HM013709    ADG03465.1    EU934244    ACH85201.1    GBBI01002050    JAC16662.1    EU861391    ACF74975.2    GU074513    ACY71070.1    GBBI01002049    JAC16663.1    ACPB03005879    KX695168    AQP31338.1    EU934240    ACH85197.1    KY705385    ARW29611.1    APGK01039300    BT127689    KB740969    KB632230    AEE62651.1    ENN76739.1    ERL90378.1    MG265913    AXU24969.1    CH933806    EDW14253.1    GFTR01007568    JAW08858.1    MG265899    AXU24955.1    EF569673    ABQ39970.1    GEBQ01026193    JAT13784.1    KT003964    ANJ86404.1    JX627810    AFX84560.1    KU311038    AMQ77288.1    KK853289    KDR08926.1    MF773976    AXB26576.1    KY705383    ARW29609.1    KQ971352    EFA07459.1    EFA07510.1    KY661325    AVA17412.1    JF421286    AEB52075.1    KQ971354    EFA07173.1    KX976473    AQP31363.1    KY705384    ARW29610.1    KU159184    AMX23517.1    HQ184405    ADX42270.1    KY231148    ARQ84028.1    AY842477    AAW32099.2    NEVH01025635    PNF15343.1    KF018929    AGT99186.1    ABLF02040542    PNF15290.1    HQ184404    ADX42267.1    ADX42268.1    KU311037    AMQ77287.1    KQ460126    KPJ17595.1    EF103584    ABL06948.1    KF771049    AHG94986.1    GAKP01020060    JAC38892.1    ADX42269.1    DQ017057    AAY28732.1    KF731995    AHF81959.1    KQ971357    KYB26038.1    KC620440    AHE77387.1    AGBW02010783    OWR47855.1   
Pfam
PF00012   HSP70
Interpro
IPR018181   Heat_shock_70_CS        + More
IPR029048   HSP70_C_sf       
IPR013126   Hsp_70_fam       
IPR029047   HSP70_peptide-bd_sf       
SUPFAM
SSF100920   SSF100920        + More
SSF100934   SSF100934       
Gene 3D
PDB
5FPN     E-value=0,     Score=2208

Ontologies

Topology

Length:
640
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00495
Exp number, first 60 AAs:
0.00042
Total prob of N-in:
0.00025
outside
1  -  640
 
 

Population Genetic Test Statistics

Pi
434.803716
Theta
238.206398
Tajima's D
2.440705
CLR
0.296102
CSRT
0.936153192340383
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
20518026 MEELTRHCSPIMTK 95.24 4e-09
20518026 WLDSNTTAEK 95.24 4e-09
20518026 TTPSYVAFTDTER 100.00 5e-07
20518026 VQTMLQNFFCGK 100.00 7e-07
20518026 WLDNNTLADQDEYEHK 100.00 3e-06
20518026 GANKCFSPEEISSMVLTK 100.00 7e-06
20518026 FAPEEISSMVLTK 100.00 7e-06
20518026 SQIHDVVLVGGSTR 100.00 3e-05
20518026 STARDACDEALR 100.00 5e-05
20518026 FDDPKIQQDMK 100.00 2e-04
20518026 IINEPTAAALAYGLDK 100.00 3e-04
20518026 VINDNGKPK 100.00 3e-04
20518026 IINEPTAAALAYGLDK 100.00 3e-04
28556443 SLGIETAGGVMTTLIK 100.00 3e-04
28556443 SLGIETAGGVMTTLIK 100.00 3e-04
20518026 DAGAIAGLNVLR 100.00 5e-04
20518026 DAGAIAGINVLR 100.00 5e-04
20518026 FAPEEISSMVLTK 100.00 0.002
25044914 DAVTFIEK 100.00 0.002
20518026 TTPSYVAFTDTERLIGDAAK 100.00 0.002
20518026 GTLEPVEKALK 100.00 0.006
20518026 SQIHDVVLVGGSTRIPK 100.00 0.009
20518026 IQIEFK 100.00 0.012
20518026 IEDVGEDEDADK 100.00 0.049
31223520 ARFEELNADLFR 100.00 0.049
26822097 FEEINADIFR 100.00 0.049
26280517 MNFSHGSHEYHAETIR 100.00 0.049
25044914 TTPQIVIR 100.00 0.049
24093152 TTPAAADVEK 100.00 0.049
24402669 TTPQIVIR 100.00 0.049
27102218 VEIIANDQGNR 100.00 0.049
28467696 TTPSSQIEQIIPSYTEIK 100.00 0.049
29197581 YPGPIQDVGNR 100.00 0.049
28556443 TTPSYVAFTDTER 100.00 0.049
28556443 TTPSYVAFTDTER 100.00 0.049
28556443 TTPSYVAFTDTER 100.00 0.049
28556443 TIEDGIFEVK 100.00 0.049
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号