SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16080
Pre Gene Modal
BGIBMGA007097
Annotation
Uncharacterized_protein_OBRU01_09374_[Operophtera_brumata]
Location in the cell
Nuclear   Reliability : 3.809
 

Sequence

CDS
ATGAGTCATCATCATGAAAGTAATAACTGTGACGTCAGCAATGCTGACGTCACACTTTTTAAAAACAATACGGAGGTTAATGTTCCGTCATCAGAAGTGGGATCACATGCTGCCTCCGCTCAGCAACAACCTGAAGCTACATCACAAATAGAACCACACCATGGATTAAATACTACAGGCAATGCTGGGAGTTCCTTGGAACAGGAACAGGAACAGCCACAATCAGCATTGCTTAACGCACCGATGAGCAGCGTACCGCCACAATTCATCATGCAGATGATGCATGTGATGCAGCAAATGTCGGAACGCTTAAGTACACCAGCAGAAACTAAGATACGTATAAATGATATTTACCTACCATCATTTGACCCCGATACTAGTGTGGGAGTACGTGAGTGGTGTCAACATATCGACAAAGCCATTGAGACTTATCGACTCAACGACTTTGACATACGCATGAAAGTTGGCAGCCTCCTAAAGGGAAGAGCGAAGATGTGGGTTGACGATTGGATGGTCACTGCAGCTTCGTGGGCTGAGCTGCGCAACAATCTTATCACGACATTCGAGCCAGAAAATCGCTATTCTCGAGACATAGCTCGATTTAGAGAACATATGTACGACTCTTCAAAGGACATCTCGGAGTTCTTGTCACGAGCTTGGGTCTTGTGGAGGAGGATCACCAAAGACAAACTACCTAATGAAGATGCAGTTGAAGCAGTTATTGGTTGCGTGAATGACGAGAAACTTAGGATCGAGCTACTGAACACAAGAGCCACAACAGTACCAGAATTGATATCTGTTGCATCATCAGTAAGAGCCATGAAGCGTTTTCACCAGGGCTCAAATAAGCTGAGTACAAATAAGCGTCCCCGTTTTTTGAATTCTACTTCATCAAATTCATCTTGCCATATCTGTAAAAGAACTAATCACACCACCAACGAATGCTACTACAAAATGGTTACCGAATCAAAGCCCGAACAAAGAAACAAAACAACAACTGAGACAACGAAGGAAGTAACCTCCTACCAGAACAATAAAACAACAATCTGTTCATTCTGCAAAATACCAGGACACAGTTTTGAAACATGCTTCAAACGTGAACGAGCATTGACATCAAACGTAAATTACGTTGCTGGATCAAAACTAGCTCCGATTCAGGTGAAGTTTGGATCAAAGAGTTTTCAGGCAATCTTTGATAGTGGCGCAGAATGCTCACTTATGCGGGAATCCGTAGCAGCTCAAATACCCGGAAAAAGACTACAAACGGCAGATTACTTGAAAGGAATTGGACAATTTCCTGTACTATCAATAGCTACACTCGTAACGGTAGGTGTCATCGATAACATCAACGTTGAATTACAGTTTCACATAGTGGCAGATTACGAGATGACTACAGATATTTTAGTGGGTATGAACTTGATAAACAATACGAACCTAACTATGACGATCACTTCGGGCGGAACGAGGCTAGCACGTCAGCCACATGTTAATCAAGTTCAGTGTATAAATCCAATTTTCGATAAACTGGATTGTGATCTCACAAATGAAGAAGATATCGCAAAATTACGCACCCTTCTAAACAAATATCAGCACCTGTTTATTAGAGGGTATCCAACAACTCGTGTCAAGACAGGTGAACTGGAAATCCGCCTGAAGAATCCAAACAAATATGTAGAACGAAGACCTTACAGGCTCAGTCCCATCGAACGAGAAAGGGTGCGAGCCATTGTGAAAGAGTTGATGGAGCATGGCATTGTACGCGAAAGCAAGTCTCCATACTCCAGTCCCATCATCTTGGTGAAGAAGAAGAATGGTGACGATCGCATTTTTTTTAAGCGCTCAATCGAATATTTGGGTAACGTAGTATCTAATGGACGACATCGAAAGGAGCATCTGGTGCGGTACAAGCTCAAATGCACCCGATTCAGAAACCGTCTGCTGCTTTTCAAGTAA
Protein
MSHHHESNNCDVSNADVTLFKNNTEVNVPSSEVGSHAASAQQQPEATSQIEPHHGLNTTGNAGSSLEQEQEQPQSALLNAPMSSVPPQFIMQMMHVMQQMSERLSTPAETKIRINDIYLPSFDPDTSVGVREWCQHIDKAIETYRLNDFDIRMKVGSLLKGRAKMWVDDWMVTAASWAELRNNLITTFEPENRYSRDIARFREHMYDSSKDISEFLSRAWVLWRRITKDKLPNEDAVEAVIGCVNDEKLRIELLNTRATTVPELISVASSVRAMKRFHQGSNKLSTNKRPRFLNSTSSNSSCHICKRTNHTTNECYYKMVTESKPEQRNKTTTETTKEVTSYQNNKTTICSFCKIPGHSFETCFKRERALTSNVNYVAGSKLAPIQVKFGSKSFQAIFDSGAECSLMRESVAAQIPGKRLQTADYLKGIGQFPVLSIATLVTVGVIDNINVELQFHIVADYEMTTDILVGMNLINNTNLTMTITSGGTRLARQPHVNQVQCINPIFDKLDCDLTNEEDIAKLRTLLNKYQHLFIRGYPTTRVKTGELEIRLKNPNKYVERRPYRLSPIERERVRAIVKELMEHGIVRESKSPYSSPIILVKKKNGDDRIFFKRSIEYLGNVVSNGRHRKEHLVRYKLKCTRFRNRLLLFK

Summary

Pfam
PF00098   zf-CCHC        + More
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF17921   Integrase_H2C2
PF17917   RT_RNaseH
PF00077   RVP
PF00665   rve
PF02037   SAP
PF12384   Peptidase_A2B
PF03732   Retrotrans_gag
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR000477   RT_dom       
IPR041577   RT_RNaseH_2       
IPR041588   Integrase_H2C2       
IPR041373   RT_RNaseH       
IPR018061   Retropepsins       
IPR001969   Aspartic_peptidase_AS       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR036397   RNaseH_sf       
IPR001995   Peptidase_A2_cat       
IPR003034   SAP_dom       
IPR036361   SAP_dom_sf       
IPR024650   Peptidase_A2B       
IPR005162   Retrotrans_gag_dom       
SUPFAM
SSF57756   SSF57756        + More
SSF50630   SSF50630       
SSF53098   SSF53098       
SSF68906   SSF68906       
Gene 3D
PDB
4OL8     E-value=0.00162608,     Score=100

Ontologies

Topology

Length:
650
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.18899
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00317
outside
1  -  650
 
 

Population Genetic Test Statistics

Pi
344.668565
Theta
188.028997
Tajima's D
2.517983
CLR
0.42347
CSRT
0.944852757362132
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号