SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16069
Pre Gene Modal
BGIBMGA009519
Annotation
Yokozuna_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.292
 

Sequence

CDS
ATGCGCTATGATAATGAAAGCAACTTACAGCAATATTTCCTAAAATTTGAAGGAATTCTTAGCGAATTAGCGGCAATCAACGTAAACGTCGATGTAGAAGATCAAATTTGCTATCTGCTGTCTTCTTTACCAAAGATATACGATCAATTAATTACATCAATTGAGACTATGGCTTCCGAGAAACAGCTGAACCTAGAATTTGTTAAAGCAAGACTACTCGATATGGAGACAAAGTTAAAAATGGACAGAAATAGTGAAAGCTATGAGAATAATGCCTTCATCACGTGCCACTCCTGCGGAAAACGTGGACACAAATCATTCGAATGCCGAAGATCAGGACGAGGACAAGGGCCGAGTAGAGGACAGTCATTGACACGAGGATGGAGCTATCCAAGATCGCGTGGACGCTCATTTAGAGGAAATTCAAGTTCACGACATACAACGTATCAACATACTTCAGCAGCAGGCAGAGACGACAAAGAAATAGGTTTCATTGCTAGCGATATTATTGCTAATGTGGGTGAATGTGGTAACATAGAACTAATTATAGACTCAGGATGTACGGAGCATTTAATAAATGAAAAATATGAAAATTATATGACGGATATTACGTACTTAGATAAACATGTCAAAATATTCGTAGCTAACGGCCAATGTATTACAACTAGTAAAAGAGGTAAACTTAAAGTAAAATATCAAAATACTACGATTAATATTGATGCTCTAATTGTGAAAGATGTTTCATACAATTTATTATCAGTAAAAAAGATTGTCGAGGCAGGTTTTAACATAAACTTTAATAAATACAATGTTAAAATATTTAATAAAAATACATTTTTACGCGGCACCGTGCAAGGAAAGTTGTATAAGCTACAAGCCGAATTATGTAAGTCCGAAGTTTGTAATGTTACTGATGCGACAGATTTATGGCACAAACATTTAGGTCACTTAAATAGGAAAAGCCTTAATATACTAAACTTACCTGTATCTAATAGAATTTGCAGTCCTTGTATGGAGGGCAAAGCCACCCGAAGCCCATTCACGCCTATCCCAAAGCCTAGAACGAAAATGACAGCCGAGATGCTTCACACAGATATAGCAGGACCGATCAGACATCAAGGACCTAATGGTGAAAAATATTTTATGACAATTATTGACGATTTCTCTCATTTTTGCGTAGTGTATCCCCTGAAGAGCAAATCTGAAGCAACAGAACGACTGATGAACTATGTATTAAGAATTGAAAACGAAACGGGGAATAAAGTTAAAAGAATTAGATGCGATAATGGTGGAGAGTACACTGCTAATAGTTTGAAACGTTTTTGCATAAATAGAGGTATTAGTTTAGAATATACATTACCATACACGCCACAACTTAATGGCATATCAGAACGGATGATCCGCACATTATGCGACAAAACGAGGACTCTATTAGCGGAAACAAATTTGCCAAAACATCTGTGGTGCGAAGCGATACAATGTGCAGTTTACCAATTAAACAGATCGCCATCATGGGCCATAAACTTCAAGACACCCAGCGAAATATTTTTTGGTAAAAACGACCTATCGAGATTGAGAGTATTTGGTTCCAAAGCTTGGGCTACTATAGTACCCAAACCGGACAAGTTTGCCAAGAGAGCAAAAGAAACAAGAATGGTAGGTTATGGAACTGTTGGTTACAGATTATGGGATCCAGAAGAAGATAAAATAGTTATTTCCAGAGATGTAAGATTTGATGAAAGCGATATTAAATTCAAAAATAACGAAGAAGTGAAACAAGTTAGATATATTCAAGACAAAGAAGAAGAAATCAATAAAGAAAAGCAAGATATTGTAGAACAGGAAGATGAATTTAAAGATGCAGAAATGAACACTGATCAAACTGAAGAAGCAATAATCAGACCCAAAAGAACGATAAATCCTCCTGCTTATCTTAAAGATTACGAGACGAATATAGAAAACATAAATGAAACTAATATTGTTATATGTCTGAGTGCACATGCACCAGAAACTTTCGAAGAAGCTATAAAAGAACCAGAATGGAAAAACGCAATCAATAAAGAGCTAGATGCACTCCAAAGACTAGAAACGTGGGAAGAACAAGAAATAACCGATGGAAGAAAACTCATAGATACAAAATGGATATTTAAACAAAAAGAAGATGGAACAAAAAAGGCAAGACTGGTAGCTAGAGGCTTCCAACAAAAGAAAAAAGATATTTTTGACAGCGTATATGCACCCGTTGCTAGACATTCAACCATAAGAATGATCTTATCAAAAGCTGTACAAGATGATTTAAAGATTATTCAGCTTGACATTCCCACTGCATTCCTAAATGGAAAATTAAAGTCTGATGTATTTATCAAAATACCCCAAGGATTAGAAATAAAAAATAATAATACAGCATTAAAACTAAAGAGAGCATTGTATGGATTGATTGAATCACCAAAATGTTGGAATGAAACACTTGACGAATTTGCGAAAGCTAACGGATTCCAAAGATCAGAATATGATTACTGTTTGTATTACAAAGAAGATTGCTGGATGCTGATTTACGTGGACGATATCCTAATCATTGGAAACGGGGAAGATATTATTAAAGCACTTAAGGAGAAGTTTAACGCAAAATATATGGGCGAAATTAAGAACTTTCTCGGAATGGAAGTTAAAAGAAATGAAGATACCTTAGAACTGAAACAAACTAAAATGATTGAAAAGATATTGACTAAATTCAAAATGGATGAATGTAACGGAATTAAAACTCCCATGGAAAGAAATTACAATATAGAAATAAAGGACAATACAGAAGTTTTGGACGTACCGTATCGAGAACTAATAGGAAGTCTAATTTATCTTACTGTAACAACAAGACCGGATTTAACATTTGCAGTGTCATATCTGAGCAGATTTTTAGATAAACCGAACGAAGAATTATGGAAAGCTGGAAAAAGAGTAGTACGTTATTTGAAAGAAACAAAAGAAAAAGGATTATTATTTAAAAAGACAAATGACAATAATTTATACGGATTTTCTGATGCCGATTGGGCTGGAGATAGAAGCGACAGAAAAAGTGTTAGCGGTGGTATTATCCTACAAGGGCAAAACCCCATTGCTTGGTTTTCAAAGAAGCAACAATGCGTAACTTTATCGTCTGCTGAAAGCGAGTATGTAGCCGCCGCATCATTAGCACAGGAAATTGTTAATTTAAAAGGCATATGTAAGCACCTAGGTTGTGATGTAAATGCCGTGCTATTTGTTGATAACAAAAGTGCGATATCAATGGCCAAGAATTACGAGAACTCTAAGCGTACAAAACACATTGATATACGGTTTCATTATATAAAAGACTTGGTTGTCAATAAGGTGATCAGCATAGAACATATTTGTACCAATGAAAATTTAGCGGATGTTATGACTAAAAGTTTGAGCACAGACAAATTTTATAAATGCATTGATAAGTTCTTGTGCTAA
Protein
MRYDNESNLQQYFLKFEGILSELAAINVNVDVEDQICYLLSSLPKIYDQLITSIETMASEKQLNLEFVKARLLDMETKLKMDRNSESYENNAFITCHSCGKRGHKSFECRRSGRGQGPSRGQSLTRGWSYPRSRGRSFRGNSSSRHTTYQHTSAAGRDDKEIGFIASDIIANVGECGNIELIIDSGCTEHLINEKYENYMTDITYLDKHVKIFVANGQCITTSKRGKLKVKYQNTTINIDALIVKDVSYNLLSVKKIVEAGFNINFNKYNVKIFNKNTFLRGTVQGKLYKLQAELCKSEVCNVTDATDLWHKHLGHLNRKSLNILNLPVSNRICSPCMEGKATRSPFTPIPKPRTKMTAEMLHTDIAGPIRHQGPNGEKYFMTIIDDFSHFCVVYPLKSKSEATERLMNYVLRIENETGNKVKRIRCDNGGEYTANSLKRFCINRGISLEYTLPYTPQLNGISERMIRTLCDKTRTLLAETNLPKHLWCEAIQCAVYQLNRSPSWAINFKTPSEIFFGKNDLSRLRVFGSKAWATIVPKPDKFAKRAKETRMVGYGTVGYRLWDPEEDKIVISRDVRFDESDIKFKNNEEVKQVRYIQDKEEEINKEKQDIVEQEDEFKDAEMNTDQTEEAIIRPKRTINPPAYLKDYETNIENINETNIVICLSAHAPETFEEAIKEPEWKNAINKELDALQRLETWEEQEITDGRKLIDTKWIFKQKEDGTKKARLVARGFQQKKKDIFDSVYAPVARHSTIRMILSKAVQDDLKIIQLDIPTAFLNGKLKSDVFIKIPQGLEIKNNNTALKLKRALYGLIESPKCWNETLDEFAKANGFQRSEYDYCLYYKEDCWMLIYVDDILIIGNGEDIIKALKEKFNAKYMGEIKNFLGMEVKRNEDTLELKQTKMIEKILTKFKMDECNGIKTPMERNYNIEIKDNTEVLDVPYRELIGSLIYLTVTTRPDLTFAVSYLSRFLDKPNEELWKAGKRVVRYLKETKEKGLLFKKTNDNNLYGFSDADWAGDRSDRKSVSGGIILQGQNPIAWFSKKQQCVTLSSAESEYVAAASLAQEIVNLKGICKHLGCDVNAVLFVDNKSAISMAKNYENSKRTKHIDIRFHYIKDLVVNKVISIEHICTNENLADVMTKSLSTDKFYKCIDKFLC

Summary

EMBL
AB014676    BAA74713.1    GDHC01015802    JAQ02827.1    GBHO01027564    JAG16040.1    + More
GBHO01004832    JAG38772.1    GDHC01019310    JAP99318.1    GEDC01012841    GEDC01000503    JAS24457.1    JAS36795.1    GBHO01035173    JAG08431.1    GDHC01007058    JAQ11571.1    GFTR01008662    JAW07764.1    LJIG01022881    KRT78250.1    JXUM01155348    KQ572178    KXJ68066.1    JXUM01085595    KQ563513    KXJ73717.1    GEZM01072005    JAV65635.1    ABLF02041793    LBMM01012492    KMQ86193.1    JXUM01136904    KQ568499    KXJ68982.1    JXUM01025857    KQ560736    KXJ81076.1    GEHC01000878    JAV46767.1    GBBI01004033    JAC14679.1    GEZM01028916    JAV86196.1    KQ483456    KYP50361.1    KQ484324    KYP35753.1    GEHC01000928    JAV46717.1    KQ483890    KYP39660.1    GAKP01015342    JAC43610.1    KQ483843    KYP40337.1    GEHC01000966    JAV46679.1    GEZM01032204    JAV84770.1    JXUM01011189    KQ560325    KXJ83029.1    NKQK01000002    PSS35035.1    OIVN01004879    SPD19723.1    KF740825    AIC77183.1    GBHO01040663    JAG02941.1    KK112142    KFM56833.1    GEDC01029908    JAS07390.1    D83003    BAA11674.1    OIVN01000557    SPC82046.1    KQ485623    KYP31853.1    CM003610    KYP61490.1    OIVN01002854    SPD06945.1    OIVN01001052    SPC89229.1    GBHO01002761    JAG40843.1    OIVN01001309    SPC92453.1    OIVN01005657    SPD23465.1    KQ484038    KYP38095.1    NKQK01000016    PSS08126.1    OIVN01001666    SPC96375.1    ASHM01015075    PNX96991.1    FJ544853    ACL97384.1    OIVN01003569    SPD12194.1    GEZM01063091    JAV69316.1    FJ544854    ACL97385.1    FJ544856    ACL97386.1    JN402333    AFB73912.1    OIVN01000036    SPC73022.1    CM003608    KYP66486.1    KQ484186    KYP36645.1    CM003607    KYP67664.1    OIVN01005059    SPD20680.1    FJ544851    ACL97383.1    FJ544857    ACL97387.1    OIVN01005024    SPD20514.1    CM003606    KYP68607.1    KQ483417    KYP53032.1    KQ483702    KYP42748.1    GEHC01000959    JAV46686.1    CM003603    KYP76810.1    OIVN01005591    SPD23209.1    KYP76811.1    CM007892    OTG31811.1    KYP77007.1    JN402332    AFB73911.1    OIVN01002904    SPD07378.1    GBHO01040573    JAG03031.1    GBHO01040574    JAG03030.1    LBMM01012645    KMQ86082.1    EF094939    EF094940    ABO36622.1    ABO36636.1    DF973299    GAU24969.1    LSMT01001145    PFX12880.1    OIVN01001022    SPC88819.1    OIVN01002680    SPD05612.1    KA648745    AFP63374.1    CM003605    KYP71150.1    CM007893    OTG30017.1    GFTR01008327    JAW08099.1    ASHM01002084    PNY07765.1    OIVN01000991    OIVN01001835    SPC88370.1    SPC98114.1    OIVN01001534    SPC95017.1    AC149291    AAT38758.1    OIVN01002055    SPD00174.1    GEZM01005617    GEZM01005616    GEZM01005615    GEZM01005614    JAV96040.1    AY009101    AAK12626.1    OIVN01004867    SPD19656.1    OIVN01006233    SPD28466.1   
Pfam
PF00665   rve        + More
PF07727   RVT_2
PF13976   gag_pre-integrs
PF00098   zf-CCHC
PF13961   DUF4219
PF13358   DDE_3
PF13855   LRR_8
PF03106   WRKY
Interpro
IPR036397   RNaseH_sf        + More
IPR039537   Retrotran_Ty1/copia-like       
IPR001584   Integrase_cat-core       
IPR013103   RVT_2       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR025724   GAG-pre-integrase_dom       
IPR025314   DUF4219       
IPR038717   Tc1-like_DDE_dom       
IPR032675   LRR_dom_sf       
IPR036576   WRKY_dom_sf       
IPR001611   Leu-rich_rpt       
IPR003657   WRKY_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF118290   SSF118290       
Gene 3D
PDB
3S3O     E-value=1.68932e-08,     Score=146

Ontologies

Topology

Subcellular location
Nucleus  
Length:
1156
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02152
Exp number, first 60 AAs:
0.01981
Total prob of N-in:
0.00107
outside
1  -  1156
 
 

Population Genetic Test Statistics

Pi
490.659689
Theta
219.433936
Tajima's D
3.898245
CLR
0
CSRT
0.998250087495625
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号