SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16055
Pre Gene Modal
BGIBMGA009320
Annotation
hypothetical_protein_AB894_15365?_partial_[Piscirickettsia_salmonis_LF-89_%3D_ATCC_VR-1361]
Location in the cell
Nuclear   Reliability : 2.9
 

Sequence

CDS
ATGTCAAAGTCAAGTACAGGTAGAGGTAAAAATAATAAAACACGTGAACGTTCTCCGAATCCTGGACTGTACCAACAACTTCAAGCGATTGTATCTCGCCTGAATGCGTTGGAAGACAATTCAAGGTCTGGTATAGCGACTGTTGTTGAGAGGCAGCCTGCGGTGGAGTCATCGGGATCGGCGGGCAGTGCTGTGGTGCCGTGCGTGGTTCTGGCTTCTGAGCAAAGCACGACACCGCCATTGGTGCCTACGCCGGTTCCACGAGTTTCCGCTGACGATTGCGTCGCTGCCGAGGTAGCCGGTAAAATTGTAAGCGCAATTAATGAATTGAATCTGGTAAGGCCGAACCATATTTATATATCAAACTTTGATCCCGATTTAAATGATATTAATGTTTGGTGTGATGAAGTTGATCATGCACGTGTCATTTATAGGTGGACCGATAGGGAGTGCTTATCTCATATTGGTAATTGCCTTAAAGGCGATGCTCGTGTGTGGTTAAATGAATGGGTCACCAATGACCGTAGCTGGTCTAATTTTAAACGCGAGTTTAAACCGTTGTGTCCCCGTCGGGTAGATGTTGCAAATATCCTTTTTGATGTTATGAAAACCGATTCCAACAACTATCCTACATACGCGGAATATGTTAGGCGATCTTTATTGCGTCTTCGCATAGTAAATGGACTTAGTGACGAATTAGTTTCAGCAATAGTGATCCGGGGTATCGTTGATCCACAAATTCGTGCGGCCGCTACAAACGCGAGGTTATTGCCTAACGATTTAGTTGAGTTTTTCTCCATATATGTAAAACCTACACCTCAAACAAAAACAAATCATAATACTCGTACTGTCGCTGGTCGCTTTCATAATACACAATTTTCATCACGTAAAAGAGAGCATAGTTCTAGTAGAACCGGTTGTTACGTATGTGGATCATTTGGCCATAGACAAGTGAATTGCCCTAAGCGAACGAGAAAACGTTCGCCTACTGTGAATGATAGATTCACATCTGTACCCGCTGCCAGCTCCTCTGTGCAGAAGCCTGAACCTTGTTCTTTTTGTAAAAAGCTGGGCCATAAAGTAGAGCAGTGTTTCTTTAAGCAGCGTTCTGAAGCTCGTGGAAAATCTAACGTGAATTTTTGCCGTGATACTGTAAATGACTATAGAAAAAATGATATAGCTACTGCGATCGTACAGGGTGTACCAGTCGATATCCTGATAGATAGTGGATCCACAGTCTCGCTTATGTCTGAATCAATTGTAAAACATTTTCAATGTAAACGAGTACCCTCATTTTGCGTGTTACGAGGAATTGGTGACTGTGACACTGAATCTCGCTATTTTACTACTTTGACAGTTGAGTTTCCCGAAATTACGCTAGAAATAGACTTTCAAATTGTTAGTGACAAGTTCATGAATACCCCAGTCATAATCGGTACTGACGTTTTGAATCGGGAAGGTGTCACGTATATTAGGAAAAAGGGCATACAGCACTTAACTCGGGTAGAAAAGGTTTTTACTGCGGAGACAACTGAACTTAATTCAATCCGTACCGTGAATACTTCATTAACAGGTGAAGAAAAAAATAAATTATTAGCTTTGGTACGAAAATTTTCAAAATACCTTATAACTGGTACCGCGGCCAGTACTGTTACAACTGGATCCATGCAAATTCGACTCAGCAATGAAACTCCTATTGTTTACAGACCTTACAAATTATCATTTAGCGAAAAACTTCGCGTTAGAGAAATTATTAAGGATCTTCTTGATAAAGGTGTGATTAGGGAGTCTGAATCGGAGTTCTCGAGTCCGATATTGCTAGTTAAGAAAAAGGACGGCAGTGACAGGATGTGCGTGGACTTTCGGGCTCTTAATGCGAATACTGTGAAGGATCGCTATCCATTGCCGTTAATAGACGATCACATTGACCGGTTAGGTAGCGCAAAATATTTTACAAGCCTCGATATGGCCACTGGTTTCCACCAGATTCCTTTAGCAAACGACTCCATTCACAAAACCGGCTGTGTGACACCCGAAGGTCATTTTGAATACCTTAAAATGCCCTACGGGTTAGCTAATGCCCCGGTTGTTTATCAACGTATTATAACTAATACTCTGAAAGCCTTTAGTGAGACAGGGAGGGCTTTAATCTATATCGATGATGTTTTAATACCTAGTCAGACCATTGATGAAGGCCTAAATACTCTGCGTGAAATCTTTGAAACACTAACTAAGGCGGGCTTCTCAATTAATTTAAAAAAATGCAAGTTTCTTGCTAACGAAATTGAATATTTGGGCAGAACTATCAGCAATGGTCAGGTTAGGCCGAGTACGTATAAAGTAGAAGCATTGACAAAAGCCCCGAAGCCTGGTAATGTTAAACAAGCTAGACAATTTTTAGAAGTACACACTGATGCTTCTTCTCGAGGGTATGGAGCTGTTTTACTTCAGACTCATGGGAATAATAATAAACGCGTGGTGGGATATTTTAGTAAAGTTACCCTAGGCGCCGAACCACGCTATCACTCCTATGAGCTGGAGACACTCGCTGTGGTCAAGGCTCTGCAGCATTTCAGGCACTACCTCATAGAAGTTTTGTGGAAACTGCAGCTCACCCTGAACGTTACGAAACAAAAGTCCACTCAATATTCACCTTTATATTTGTTAATTGGTAGCGATGCTGTGACGCCCGTCATTCGTTCCGTTGTACGCGATGTGGCTCTAGAAGGAACAAGTGCCAACAGAGAAACCTTACGCGAGCTTGCCCGACAAAGAGCTTCTCAACTGCTGGACAAAAACCGAAAACAGCAGGACACTCGAGTAAATGAACGGCGCAAACCCCCGCGTACTTTCCATGAAAACGACGTGGTCTTCGTGCATAAGAATAGCCAATCTGTTGGAAAGCTGGATTCTGGTATGCGTGGCCCGTACAAAATAGTGCGTGCGCTGCCACATGGACGTTATGAACTGAAGCTTCTTTCTGGCTCACTTGGGAAGACCACGGAAGCTGCTGCCGAATTTATAAGTGCGTGGCACGGAGAGTGGACGCCGGATGTGTGCACCGCATTTTTCGAGTGTGATGAGAATAGCTCTGAGGAAGGTATTGTCGCCGATTCATCACACCACCATGACGACATAGTACCTCTAGACGAACCTATTAATGCGGGCGAGGACGCTCCGCCGTCAGGAGAGGCCGTGTTAGAAGATGATGATGACATTGGAGGCGTGGCCTAA
Protein
MSKSSTGRGKNNKTRERSPNPGLYQQLQAIVSRLNALEDNSRSGIATVVERQPAVESSGSAGSAVVPCVVLASEQSTTPPLVPTPVPRVSADDCVAAEVAGKIVSAINELNLVRPNHIYISNFDPDLNDINVWCDEVDHARVIYRWTDRECLSHIGNCLKGDARVWLNEWVTNDRSWSNFKREFKPLCPRRVDVANILFDVMKTDSNNYPTYAEYVRRSLLRLRIVNGLSDELVSAIVIRGIVDPQIRAAATNARLLPNDLVEFFSIYVKPTPQTKTNHNTRTVAGRFHNTQFSSRKREHSSSRTGCYVCGSFGHRQVNCPKRTRKRSPTVNDRFTSVPAASSSVQKPEPCSFCKKLGHKVEQCFFKQRSEARGKSNVNFCRDTVNDYRKNDIATAIVQGVPVDILIDSGSTVSLMSESIVKHFQCKRVPSFCVLRGIGDCDTESRYFTTLTVEFPEITLEIDFQIVSDKFMNTPVIIGTDVLNREGVTYIRKKGIQHLTRVEKVFTAETTELNSIRTVNTSLTGEEKNKLLALVRKFSKYLITGTAASTVTTGSMQIRLSNETPIVYRPYKLSFSEKLRVREIIKDLLDKGVIRESESEFSSPILLVKKKDGSDRMCVDFRALNANTVKDRYPLPLIDDHIDRLGSAKYFTSLDMATGFHQIPLANDSIHKTGCVTPEGHFEYLKMPYGLANAPVVYQRIITNTLKAFSETGRALIYIDDVLIPSQTIDEGLNTLREIFETLTKAGFSINLKKCKFLANEIEYLGRTISNGQVRPSTYKVEALTKAPKPGNVKQARQFLEVHTDASSRGYGAVLLQTHGNNNKRVVGYFSKVTLGAEPRYHSYELETLAVVKALQHFRHYLIEVLWKLQLTLNVTKQKSTQYSPLYLLIGSDAVTPVIRSVVRDVALEGTSANRETLRELARQRASQLLDKNRKQQDTRVNERRKPPRTFHENDVVFVHKNSQSVGKLDSGMRGPYKIVRALPHGRYELKLLSGSLGKTTEAAAEFISAWHGEWTPDVCTAFFECDENSSEEGIVADSSHHHDDIVPLDEPINAGEDAPPSGEAVLEDDDDIGGVA

Summary

Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00077   RVP
PF00665   rve
PF03732   Retrotrans_gag
PF00098   zf-CCHC
PF17917   RT_RNaseH
PF02145   Rap_GAP
PF02037   SAP
Interpro
IPR001969   Aspartic_peptidase_AS        + More
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR001995   Peptidase_A2_cat       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR018061   Retropepsins       
IPR036397   RNaseH_sf       
IPR036875   Znf_CCHC_sf       
IPR005162   Retrotrans_gag_dom       
IPR041373   RT_RNaseH       
IPR000331   Rap_GAP_dom       
IPR035974   Rap/Ran-GAP_sf       
IPR036361   SAP_dom_sf       
IPR003034   SAP_dom       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
SSF111347   SSF111347       
SSF68906   SSF68906       
PDB
4OL8     E-value=8.46472e-47,     Score=476

Ontologies

Topology

Length:
1077
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00899999999999999
Exp number, first 60 AAs:
0.00032
Total prob of N-in:
0.00040
outside
1  -  1077
 
 

Population Genetic Test Statistics

Pi
269.768404
Theta
165.027065
Tajima's D
3.111156
CLR
0.52794
CSRT
0.983450827458627
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号