SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16054  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA004586
Annotation
PREDICTED:_trehalase-2_isoform_X1_[Bombyx_mori]
Full name
Trehalase      
Alternative Name
Alpha-trehalose glucohydrolase
Alpha,alpha-trehalase
Alpha,alpha-trehalose glucohydrolase
Location in the cell
Cytoplasmic   Reliability : 1.654
 

Sequence

CDS
ATGTTTATGGTGTGGCTTTGGGTCGGTTTTGCGATGGCCGCTAGTGTCGTTGCTGATCGTAGCAAACTACCTCCTGCCTGTGATAGTATGATTTACTGCCACGGACCGTTGTTAAACACGGTCCAAATGGCAGGCCTCTACAATGACTCCAAGACGTTTGTGGATATGAAAATTAAAATGTCACCAAAGATCACCTTGGAGCACTTCTATGACATGATGAGCAGGACAGATTCTAATCCGACTAAAGCGGACATACAGGAGTTCGTGAATCAGAACTTCGATCCTGAGGGTTCGGAATTTGAAGACTGGAGGCCCAGTGATTGGAAGCATAACCCTGGATTTCTTGCTAAAATCAAGGATCCGTTATTGCACAAATGGGCATCAGCCTTGAACGATTTATGGCTCGATCTCGGGAGGAAGATGAAGGAAGCAGTCAAAGAGAGTCCAGACTTATACTCCATTATATACGTGGAGCATCCTTTTATTGTTCCAGGTGGTCGTTTCCGTGAGTTCTACTACTGGGACTCGTACTGGATCATCAAAGGTCTGCTGCTCTCGGAGATGAGGACCACAGCGAAGGGCATGGTCAACAACTTACTCAGCATAGTCGATAGATACGGTTTCATACCGAATGGCGGCAGAATTTATTATCTTATGAGATCTCAACCTCCCCTTCTAATACCGATGGTGCAGCTACTAATGGAAGACACCGATGACCTGGAATACCTGAGGGAGCACATCCACACCCTGGACAAAGAGTTCGACTACTGGATGACGAATCACACCATCGAAATTAACCACGAAGGGAAGAAATTGAAAATGGCGATGTACATGGATAATTCTCAGGGTCCGAGGCCGGAGAGCTACAAAGAAGACGTCGACTGTGCTAGACATTTTGACACAACTGAGAAGAAAGAAGAATTGTACGCTGAATTGAAGGCTGCAGCTGAATCCGGCTGGGATTTCTCATCAAGATGGTTTATACTGAACGGAACCAATAAAGGTAATCTAACTAATTTGAAGGTGAGGTCGATAATTCCCGTCGACCTCAACGCGATCTTGTGCTGGAACGCGCAGCTCATGATGGAGTACCACACCCGCCTTCAAAATGAGGAGAAAGCATCTTACTATAGGCGGATACACGATGACTTCATGGAAGCTATCGAAGAGCTATTGTGGCACGAAGACGTGGGAGCTTGGTTGGACTACAGCCTCGAGTCTGGTCGCAGGAGAGACTACTTTTACCCATCCAACCTGTCTCCGCTCTGGGCCGGCAGCTTCGATAAAGCGAGAAAGGATTATTTCGTGAATAGGGTCATCAATTATTTGGACAAAGTTAAGATGGACATCTTCGAAGGCGGAATCCCAACAACGTTCGAACATACCGGCGAACAGTGGGACTATCCCAACGCGTGGCCGCCCCTCCAGTACATCGTCATAATGGGACTAGCCAACACCGGGCACCCGGAGGCGATGAGATACGCCACCGAACTCGCCACTAAGTGGGTGCGGAGTAACTTCGAAGTCTGGAAGCAGAAGGCCGCCATGCTGGAGAAGTACGACGCCACGATTCTGGGTGGGCTGGGTGGCGGCGGAGAATACGTCGTCCAAACCGGTTTCGGATGGAGCAATGGCGTTGTGATGTCACTCCTAAACAGATATGGAGACGTAATCTCGGCAGCCGACAACTTCGGAACGGCGGCGGAATCGGGCGCTGTCTACGGCGCCGGGGTGGGCGCCGGTGGCGTAGTCACGGCGCTCCTAGTGGTCCTAGCTTCTTTGGCTGCTGGAACTTTAGGATTAATGGTGTACAAGAGACGTAAAGATTACGCCGGCTTCTGTAACGGCGAAGTCGACAAACTCATCTCGAAAAAACCCTACACTGAACTCAAGAGTTTGAACGGCGCGTCGAACCAGAAACAGCGGTGA
Protein
MFMVWLWVGFAMAASVVADRSKLPPACDSMIYCHGPLLNTVQMAGLYNDSKTFVDMKIKMSPKITLEHFYDMMSRTDSNPTKADIQEFVNQNFDPEGSEFEDWRPSDWKHNPGFLAKIKDPLLHKWASALNDLWLDLGRKMKEAVKESPDLYSIIYVEHPFIVPGGRFREFYYWDSYWIIKGLLLSEMRTTAKGMVNNLLSIVDRYGFIPNGGRIYYLMRSQPPLLIPMVQLLMEDTDDLEYLREHIHTLDKEFDYWMTNHTIEINHEGKKLKMAMYMDNSQGPRPESYKEDVDCARHFDTTEKKEELYAELKAAAESGWDFSSRWFILNGTNKGNLTNLKVRSIIPVDLNAILCWNAQLMMEYHTRLQNEEKASYYRRIHDDFMEAIEELLWHEDVGAWLDYSLESGRRRDYFYPSNLSPLWAGSFDKARKDYFVNRVINYLDKVKMDIFEGGIPTTFEHTGEQWDYPNAWPPLQYIVIMGLANTGHPEAMRYATELATKWVRSNFEVWKQKAAMLEKYDATILGGLGGGGEYVVQTGFGWSNGVVMSLLNRYGDVISAADNFGTAAESGAVYGAGVGAGGVVTALLVVLASLAAGTLGLMVYKRRKDYAGFCNGEVDKLISKKPYTELKSLNGASNQKQR

Summary

Catalytic Activity
alpha,alpha-trehalose + H2O = alpha-D-glucose + beta-D-glucose
Biophysicochemical Properties
0.66 mM for alpha,alpha-trehalose (in 0.1 M sodium phosphate pH 6.75, at 35 degrees Celsius)
0.52 mM for alpha,alpha-trehalose (in 50 mM sodium phosphate pH 6.6, at 35 degrees Celsius)
Subunit
Monomer.
Similarity
Belongs to the glycosyl hydrolase 37 family.
Keywords
Complete proteome   Direct protein sequencing   Glycoprotein   Glycosidase   Hydrolase   Membrane   Reference proteome   Signal   Transmembrane   Transmembrane helix  
Feature
chain  Trehalase
EC Number
3.2.1.28
EMBL
AB162717    BAE45249.1    BABH01025716    EU872435    ACF94698.1    EU106080    + More
ABU95354.1    KU977457    ARD05075.1    KJ652558    AJK29980.1    GU211890    ADA63845.1    MG787168    AYO46921.1    KZ150067    PZC74122.1    KU640202    ANY30159.1    EF426723    ABO20845.1    KX010600    ANC68249.1    AGBW02012867    OWR44309.1    KK857312    PTY27036.1    JX312193    AGL34007.2    GEBQ01027776    JAT12201.1    GEBQ01031162    JAT08815.1    GBHO01031362    JAG12242.1    GBRD01002317    JAG63504.1    GDHC01009483    JAQ09146.1    JX024262    AFV79627.1    GECZ01025694    JAS44075.1    KY400004    KY400005    KY400006    AQY15496.1    JQ027051    AFL03410.1    KX371565    AQV08187.1    FJ790320    ACN85421.1    JX204291    AFO54713.1    PYGN01000293    PSN49112.1    JR036191    JR036192    JR036193    JR036194    JR036195    JR036196    AEY56985.1    AEY56986.1    AEY56987.1    AEY56988.1    AEY56989.1    AEY56990.1    KU756286    AOT99589.1    GGMS01000994    MBY70197.1    GL434492    EFN74859.1    NEVH01021237    PNF19664.1    GQ397451    ACV20872.1    PNF19666.1    AB301556    BAF81545.1    GEDC01008038    JAS29260.1    GEDC01000986    JAS36312.1    KQ759866    OAD62478.1    GFXV01001141    MBW12946.1    ABLF02022564    KQ971307    EFA11183.1    GL448204    EFN85130.1    JN565077    AEW67359.1    QOIP01000004    RLU23209.1    GALX01000767    JAB67699.1    KX349225    AOT82130.1    NEVH01018420    PNF23300.1    KQ976500    KYM83241.1    DS235248    EEB13930.1    KK852732    KDR17472.1    GEDC01001832    JAS35466.1    GBYB01015126    JAG84893.1    GBYB01015125    JAG84892.1    KK852980    KDR13013.1    KK107638    EZA48385.1    KQ981673    KYN38309.1    GL761864    EFZ22607.1    ADTU01011229    ADTU01011230    ADTU01011231    GL888932    EGI57245.1    GBYB01015124    JAG84891.1    UFQS01001260    UFQT01001260    SSX10014.1    SSX29736.1    PYGN01000262    PSN49799.1    KQ980581    KYN15329.1    KB632384    ERL94231.1    UFQS01001328    UFQT01001328    SSX10371.1    SSX30059.1    GBBI01002113    JAC16599.1    ACPB03020626    LBMM01000908    KMQ97237.1    GFTR01007580    JAW08846.1    GEZM01054933    GEZM01054930    GEZM01054928    GEZM01054926    JAV73338.1    GEZM01054932    GEZM01054931    GEZM01054929    GEZM01054927    JAV73335.1    KX371563    AQV08185.1    KQ982981    KYQ48550.1    KQ414934    KOC59334.1    KQ977445    KYN02611.1    GBXI01006976    JAD07316.1    DS235886    EEB20464.1    KZ288356    PBC27182.1    HQ231258    ADT91708.1    JQ228448    GAKP01013934    GAKP01013922    GAKP01013920    AFI80736.1    JAC45018.1    GAKP01013914    JAC45038.1    GFDF01001610    JAV12474.1    AJVK01017190    AJVK01017191    GAKP01013928    GAKP01013925    GAKP01013915    JAC45037.1    GFDF01001606    JAV12478.1    GFDF01001609    JAV12475.1    GAKP01013929    JAC45023.1    GAKP01013933    GAKP01013926    JAC45019.1    GFDF01001605    JAV12479.1   
Pfam
PF01204   Trehalase
Interpro
IPR001661   Glyco_hydro_37        + More
IPR018232   Glyco_hydro_37_CS       
IPR012341   6hp_glycosidase-like_sf       
IPR008928   6-hairpin_glycosidase_sf       
SUPFAM
SSF48208   SSF48208       
Gene 3D
PDB
5Z6H     E-value=9.22848e-64,     Score=620

Ontologies

Topology

Subcellular location
Membrane  
SignalP
Position:   1 - 18,         Likelihood:  0.994838
 
 
Length:
642
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
24.23578
Exp number, first 60 AAs:
0.15974
Total prob of N-in:
0.00955
outside
1  -  581
TMhelix
582  -  604
inside
605  -  642
 
 

Population Genetic Test Statistics

Pi
316.435468
Theta
160.485393
Tajima's D
3.462168
CLR
0.186435
CSRT
0.992250387480626
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28467696 MAMIGDGDSTSR 100.00 4e-11
28556443 ELSDIVTK 100.00 3e-09
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号