SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16051
Pre Gene Modal
BGIBMGA004565
Annotation
PREDICTED:_uncharacterized_protein_LOC106720343_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 3.495
 

Sequence

CDS
ATGACAAAGCCGCGCACACGTCGTCAGTCTCGTCGACAATCCGAGTATTTCGAACCGACAGAGGACGATTCTTCCCCGCCGCCGACTGCATCGGGAAACATTTCCGTCAACGACATGGTCGCCATGATGTCTACGTGGCAACGCAACCAAGAGGAAACGTTTGAGAAACTTCTACATACAGTTCTCAACCAATCGCACCGGTCATCGCCGCCGCCCGCTCAACCTGCACTTGGAAACTTCGCCTCGTGCAAGGCTCGCTACAGCGGAGCGCCAGACGAATCACTTGACGGATTTATAGACGCCGTAGAGGCCTACAAGGAATGTGCAAACGTAAGCGAAACTAATGCACTACGTGGGTTGTCAATGTTGTTAACTCATGAAGCCGCGACATGGTGGCAAGGAGTTAAGACCACCATGAACAAGTGGGACCACGCCCTCACATCCCTAAGAGGTGCGTTTGGTGATAGCCGACCTCCACATCGTATATACAAGGAGCTGTTCGCCAACCCACAAAAAGCAAGTGAGAAAACAGAACTCTTCATCTCTAAAACTCGAGCGCTACTATCACGTCTGCCAAAGGACGATCTGACAACCAAAGTACAGATGGACATGGTATATGGACTACTACATAGTAAAATACGCGAGCGTTTGAGAAGAGAGGAGATTGACACATTTGACACGCTACTCAGAAAGTCTAGAGAGATAGAAGAATCTTGTGACGAGAGTCTATCAACTAGTGGCCTTCAGAGCAAACTGCGCCAACGCCAGTTTCCACCGCCTCGTCACGCCGCAAGCATCGCCGCTGTCCAGGGGTCAACGACCGCGCCACCACTACCACCGCAGAGCGCGCCTAAGCCGCCTGCGCCCGCCGTTGAGTCCAGCGCCCACGGCACCTATCGCCGTTCTCTTCGCTGCTCCGTGGTGCCGCCCCCACCGTCGTCTCCACAACCCCACGGCTCTTCTACTCAGTTCGTGAACGCCAGACGTCGATATTGTTTCTATTGCAAGAACTATGGACATACACGTGAAGAGTGTCGTAGGTTAGCAGCTAAAGGCAAACAGGACATCGATAACGCCGCCGACCCCGTCCCGTCGTGTTACGGATGCAACGAGAAAGGTGTCACTCGATCACAGTGTGCTAAATGCAATTCGGACTTCTCTGCGTGTGAATACGACGGTCCGAAAGGCGCGCTGATGGGAATTTACGGTACAAGGTACTCCACCACTGTTATCAAATCATCTTGTAATAAGGATGAGACCCAGATGTCCGACTCGTACATGTGGAAAGAACAGATTCACACTCTAATGAAGGGCGGAGAGAGCGAGTCCGACATATCGGACTCAGAGCATTTCCTCACAAAGGGCGCCTTCCTTCTCACTCCCTCCCACGGCCTCAGCATGGAAAAAGCCTCCGCCATCTGTGAGAAGATGGAGTTCAAGGGATGCTTCTCCCTGACGAAGACTGCTACTGGAATACTCTTTAAGTTTTCCAGCGTCGATGACTATCAGATGGTATTCAAGAAAGGTTTCCATAAAGTTACCGGATCGCGGTTCTATAGGAAGATCGCTATTCCGTGCAGACCGCAGAAGACCTTTACCATTTACGTATACGACATTCCCGATGAGATCCCAGAGGAGGATGTGCGCCACGCTTTGTACAAATTTACTTCGGTCGTTGAGGTCGTCAGGCTGTATTACTCTGGATCCCCAAAAGACGGGAACACTGGTACATCGACTCCAAAACCAGAGAAGACCTCGTCCCGAGCTCTCACGACTATTGATGGAGAGCTCGTGAGCAGCATGGTGCCGAAGGAAGCCACGAGCGTGGTCCGTGTCACTCTCGCCAACATCGAGGAAGCCAACATTCTGCTGCAAAACGGCCTGGATTTCTACGGAGCTACGTTCTTTCCAACCGAATTAGCTACCCCAACCCAGGCAGCTAAGTTGATTAAGCCTAGCAACAGAGTAACTGGAGGTACCGTGTCAGCCAGAGTCCGTGATTTGCTCCCGGTTTTCGACCAGCAAGGATTCGCCAAGTTCGCTCCACCGGCCTCTAGACTGGTGAAGCCACGTTCCAAGTGA
Protein
MTKPRTRRQSRRQSEYFEPTEDDSSPPPTASGNISVNDMVAMMSTWQRNQEETFEKLLHTVLNQSHRSSPPPAQPALGNFASCKARYSGAPDESLDGFIDAVEAYKECANVSETNALRGLSMLLTHEAATWWQGVKTTMNKWDHALTSLRGAFGDSRPPHRIYKELFANPQKASEKTELFISKTRALLSRLPKDDLTTKVQMDMVYGLLHSKIRERLRREEIDTFDTLLRKSREIEESCDESLSTSGLQSKLRQRQFPPPRHAASIAAVQGSTTAPPLPPQSAPKPPAPAVESSAHGTYRRSLRCSVVPPPPSSPQPHGSSTQFVNARRRYCFYCKNYGHTREECRRLAAKGKQDIDNAADPVPSCYGCNEKGVTRSQCAKCNSDFSACEYDGPKGALMGIYGTRYSTTVIKSSCNKDETQMSDSYMWKEQIHTLMKGGESESDISDSEHFLTKGAFLLTPSHGLSMEKASAICEKMEFKGCFSLTKTATGILFKFSSVDDYQMVFKKGFHKVTGSRFYRKIAIPCRPQKTFTIYVYDIPDEIPEEDVRHALYKFTSVVEVVRLYYSGSPKDGNTGTSTPKPEKTSSRALTTIDGELVSSMVPKEATSVVRVTLANIEEANILLQNGLDFYGATFFPTELATPTQAAKLIKPSNRVTGGTVSARVRDLLPVFDQQGFAKFAPPASRLVKPRSK

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
693
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00991999999999998
Exp number, first 60 AAs:
0.00015
Total prob of N-in:
0.00345
outside
1  -  693
 
 

Population Genetic Test Statistics

Pi
350.892092
Theta
178.233382
Tajima's D
3.257576
CLR
105.902143
CSRT
0.988800559972001
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号