SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16043
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_uncharacterized_protein_LOC106708942_[Papilio_machaon]
Location in the cell
Mitochondrial   Reliability : 1.318 Nuclear   Reliability : 1.224
 

Sequence

CDS
ATGATCGAGAGCTGGTCAACGGTCACCCGTAGGGGTGCTCGACCGAGGGAGGAAGCAGTGAGGACGGTTCCAGCGGCAGCTATCGCTGAAGCGGAAAGGAAAGACCGGTCTTCTGTAAAGAGGAAAGAGAAGAAGCTGCGCCCTCCACGCACTCAGGCCGTTGTCCTCAAGCTGCAACCAGAGGCCGTGGAAAGAGGACTCACGTACCGCACTGTACTCGCCGAAGCGAGGGCCAAGGTAGATCCTGAGGCACTTGGAATACCCATCCAGCGCATCCGGTCTGCAGTGACTGGGTCTAAGGTGCTGGTAGTGGAAGAAGGGGTCATAGTGACCAGGCCAGTAACGACTGCAGCCATCCGCATCAGCGGACTGGACGACTCCCTGATGCCGGAGGAACTTACCGCGGAGCTTGCCTGGATTGGCGAATGCGCTCCTGATGCGGTGAAGATCGGAGACATCAAGTATGGCCCAGGCGGGATGGGTCAAGTATTGGTCCGGTTGCCCGTCGTTGCCACGATGAAGGTTCTCGCCGTTCCAAAACTGAGGGTTGGTTGGAGCGTGCTCCGCGCTTGTTTGTTAGAGGCTAAGAAGCTACAGTGCTTCCGATGCCATGAGCTAGGGCACGTGAGCGCCCGATGTCCTTCGTCGGTTGACCGCAGCCGGGATTGTTATCGGTGCGGCCAGACCGGCCACGTAGCGGCCGGCTGCTCTCTTGCACCACACTGCGCTGGGAATCTCAACCATTGCGCCAGAGCTCAGGACCTTTTGTTCCAGAGCATGGCGGAGGGGTTGACCCATCTTGCGGTGGTCGCCGAGCCGTATCGGGTCCCTTCGAGCCCCGATTGGGCGGCCGATTTGGAGGGCCGAGTGGCAATCATCCGGCGTTGTTGTGTGGGTGCTCCGCCTACGTTTGCCGTTGTTGAAAGAGGTCGCGGCTTCGTTGCCGTCCTCTGGGCCGAGATATTCGTGTTGGGAGTGTACTTTTCCCCAAACAGGACGCTCGCCGAGTTTGAGGTTTTCCTCAGCGAGCTCAGCCGCGTCGTTGGAAGGTCGCACTTCCGACGGATTCTCGTTCTCGGTGACCTAAATGCCAAGTCATTGTCTTGGGGTTCCTCTAGGACGTGCCCCAGAGGTAGAGCGGTGGAGGAGTGGCTGGTCGGAAGCGGTCTCCTCATCGTCAATCGCGGTACGGAACTCACATGCGTGCGACGTTTGGGCGGGTCCGTGGTGGACGTTACATTCGCCACGCCTGACGTCGCATATCGCGTACGCGGTTGGGCGGTGATGGTTGGCGAGGAGACCCTCTCCGACCACCGTTACATCCGATTCAGTGTCGCCGTGACCCCGGTGGGTTCTGTTCGGGGCTTTTCCTTGCCCATCAGTGGCAGCGCTAGGGGTCCTCGTTGGGCCCAGAAGCGCCTCAACATCGAGCGGTTGCGTGAGGCGGCCATAGTGCAGGCGTGGCGTCTTGACTCGCTTGGCGAGCCAGCAGACGTGTGCGAGGGGGTGGAGCGTCTGCGCGAGGCAATGTCACGGGTGTGTGACGCTGCTATGCCTCGCGTGAGAGCTCTCGCTCCTAAGCGCCAAGTTCATTGGTGGACCGAGGAGATCGCCAGCCAGCGCCGGCTATGCGATATTAGTCGTCGCACATACCAGCGATATCGACGACGAAGAACGCGCCGGGACCCCAACGAGGAGGACCGCCTGTACGAAGTGTACAGGACGGCGATAAGAACCCTGCGCTTGGCTATCGGGGAAGCGAAGGAGGCCGCCTGGAACGACCTACTGGCCTCGCTGGACCGTGACCCGTGGGGGCGGCCCTACAGGCTGGCGCGTAATGCGCTTCGCCGTTGGGCTCCTCCCGCAACCAGCACCCTGCCGCCGGAAACATTGCAGCGGGTAGTCGGGGGTCTGTTTCCCGATTTATCCGGGACGGCCTTCGTCCCCCCTGTGATGACAATGGCGCGGAATGCTGATAGCGAAGAGCTTGAGGACGTCTCCCAGGTGGAGTTCGATTTAGCTGTGCAGAGGATGCGGGCTAAGCGCACGGCACCCGGTCCCGATGGGATCTCGTCCCAAGCGTGGGCGCTCGCCTTGACAGGTGACGGCTTGGGGCCTGCCCTCCAAGGGCTATTCAGCAGGTGCCTCCGTGAGGGCAGGTTCCCAGAGCCATGGAAGACTGGTCGGCTTGTCCTTATTCCTAAGGAAGGCCGGCCACGTGACGAGCCAAGCGGCCTCCGTCCTGAGAAGAATTGGCAAGCAATCGTCGTGCTGGACGAGGCTGGTAAGCTCCTCGAGCGCATCGTCGCCAGTCGCCTCGTCCAGCACCTCGAAAGCGTTGGGCCTGACCTGGCTCCTAACCAATATGGTTTCCGGAGAGGTCGCTCCACCATGGACGCGGTCTTGCGCGTCCGCCACCTCTCCGATCGTGCGTGCTCCGAGGGGGGCGTGTTGTTGGCTGTGTCGATTGATATCGCCAACGCCTTCAACACGATCCCTTGGAGCACGATCGTGGAATCGCTCCGGTTTCACCGCGTCCCCCCTAGTCTCCGGACCCTGATAGAGGATTACCTCTCAGGGCGAAATGTAGTCTTCCCCGAGAGGAGGGGGTGGGGACGGAAAGCGGTGTCGTGCGGGGTCCCGCAGGGGTCGGTACTGGGACCACTCCTGTGGGACATCGGTTTCGACTGGGTCCTGCGCGGTGCTAGCCTGCGTGGCGTCGACGTAGTGTGCTATGCCGACGACACGCTGGTGACGGCCCGCGGAGCCGACTACAGAGCCGCAGCGATCCTTGCGACGGCGGCGGTCTCCACCGTCGTTAGTCGCATTCGGAGATTAGGTCTTGAGGTGGCCCTCCGCAAGTCCGAAGCGGTGTGCTTTCACCCAGTCCGGAGGGGACCTCCTCCGGGAGCGAATCTCATAGTCGGCGGAGCATCGATCGCTGTCCAGCCGAAGCTCAAATATTTGGGTCTTGTGCTGGACAGTCGATGGCGCTTCGACCACCACTTTGGTGAGTTAGTCCCGAAGCTGCTGGGGATGGCGGGCGCACTAGCCCGTCTTCTCCCCAACGTCGGTGGTTGCAGCGCCGGCGTCCGGCGTCTGTACCTGGGGGTCGTGCGCAGTATGGCTTTGTACGGCGCTCCCGTGTGGTCGCCCGCACTCTCTGCGCGCAATGCAGCTTTGCTGCTACGAGCGCAGCGGGTGCTCGCGGTGAGAGTCATCAGGGGGTACCGTACGATCTCCCGGGAGGTCGCCTGCGCCCTCGCCGGTTCCCTTCCTTGGGATCTCGAGGCTGAGGTAGCAGCTGCGGTATACCGGCGCAGAACACAGTCCCTGAGTCGGGGACGGACGCCCGGCCCGTCGGCTGTCGGTCGGTGGAGGCGTGCTGCGCGTCATCTGGCGTACGCCAAGTGGAGGGAGCGGTTGCTGGAGGAGCTTGGCCAAACTTCAGTCACTCGCCGACGCACCCTCGAGGCCCTGGTGCCCGTGCTGGAGGCATGGTCAGATAGACGACACGGCGTGCTCTCCTTCCACTTAACGCAGGTCCTCTCGGGGCATGGTTGCTTCGGGAGGTACCTGTGGAAGGTCTGCAGGAGAGAGCCACATCCGGGTTGCCACCAGTGCGGGCATCCGGACGATGACGCTCAGCACGCACTCGAAGCATGCCCGCGTTGGGAGCGCTCGCGGCGAGACCTCATCGCGGTGCTGGGGAGAGACCTCTCCTTGCGGGCTGTCATCGCCCGCATGCTAGAGGACCAGAATTCTTGGGAGGCCATGATCAGGTTTTGCGACCTGGTCATGGCGTTCCGTGAGGCTGAGGAGCGCGAAAGGGAGTGGGATCCCTCTTCGGCTTCACAGCGAAGAAGGCGGAGTGGGCGGCACGGGCGCGAAGCTCCCGTTCATCTCCCGTAG
Protein
MIESWSTVTRRGARPREEAVRTVPAAAIAEAERKDRSSVKRKEKKLRPPRTQAVVLKLQPEAVERGLTYRTVLAEARAKVDPEALGIPIQRIRSAVTGSKVLVVEEGVIVTRPVTTAAIRISGLDDSLMPEELTAELAWIGECAPDAVKIGDIKYGPGGMGQVLVRLPVVATMKVLAVPKLRVGWSVLRACLLEAKKLQCFRCHELGHVSARCPSSVDRSRDCYRCGQTGHVAAGCSLAPHCAGNLNHCARAQDLLFQSMAEGLTHLAVVAEPYRVPSSPDWAADLEGRVAIIRRCCVGAPPTFAVVERGRGFVAVLWAEIFVLGVYFSPNRTLAEFEVFLSELSRVVGRSHFRRILVLGDLNAKSLSWGSSRTCPRGRAVEEWLVGSGLLIVNRGTELTCVRRLGGSVVDVTFATPDVAYRVRGWAVMVGEETLSDHRYIRFSVAVTPVGSVRGFSLPISGSARGPRWAQKRLNIERLREAAIVQAWRLDSLGEPADVCEGVERLREAMSRVCDAAMPRVRALAPKRQVHWWTEEIASQRRLCDISRRTYQRYRRRRTRRDPNEEDRLYEVYRTAIRTLRLAIGEAKEAAWNDLLASLDRDPWGRPYRLARNALRRWAPPATSTLPPETLQRVVGGLFPDLSGTAFVPPVMTMARNADSEELEDVSQVEFDLAVQRMRAKRTAPGPDGISSQAWALALTGDGLGPALQGLFSRCLREGRFPEPWKTGRLVLIPKEGRPRDEPSGLRPEKNWQAIVVLDEAGKLLERIVASRLVQHLESVGPDLAPNQYGFRRGRSTMDAVLRVRHLSDRACSEGGVLLAVSIDIANAFNTIPWSTIVESLRFHRVPPSLRTLIEDYLSGRNVVFPERRGWGRKAVSCGVPQGSVLGPLLWDIGFDWVLRGASLRGVDVVCYADDTLVTARGADYRAAAILATAAVSTVVSRIRRLGLEVALRKSEAVCFHPVRRGPPPGANLIVGGASIAVQPKLKYLGLVLDSRWRFDHHFGELVPKLLGMAGALARLLPNVGGCSAGVRRLYLGVVRSMALYGAPVWSPALSARNAALLLRAQRVLAVRVIRGYRTISREVACALAGSLPWDLEAEVAAAVYRRRTQSLSRGRTPGPSAVGRWRRAARHLAYAKWRERLLEELGQTSVTRRRTLEALVPVLEAWSDRRHGVLSFHLTQVLSGHGCFGRYLWKVCRREPHPGCHQCGHPDDDAQHALEACPRWERSRRDLIAVLGRDLSLRAVIARMLEDQNSWEAMIRFCDLVMAFREAEEREREWDPSSASQRRRRSGRHGREAPVHLP

Summary

EMBL
D85594    BAA19776.1    AB078931    BAC06456.1    AB078929    BAC06452.1    + More
AB078930    BAC06454.1    AB078935    BAC06462.1    AB090825    BAC57926.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    LBMM01004272    KMQ92618.1    LBMM01006954    KMQ90166.1    LBMM01005474    KMQ91485.1    LBMM01012412    KMQ86235.1    LBMM01003988    KMQ92922.1    LBMM01006671    KMQ90407.1    LBMM01008445    KMQ88871.1    LBMM01015025    KMQ84953.1    LBMM01007036    KMQ90099.1    LBMM01008448    KMQ88867.1    LBMM01004634    KMQ92224.1    LBMM01008278    KMQ89009.1    LBMM01002052    KMQ95336.1    LBMM01006657    KMQ90417.1    LBMM01014122    KMQ85315.1    RSAL01003504    RVE40273.1    ABLF02041886    LBMM01008422    KMQ88894.1    ABLF02011238    ABLF02018942    ABLF02041885    LBMM01006996    KMQ90130.1    GGMR01015159    MBY27778.1    LBMM01015285    KMQ84870.1    ABLF02011183    ABLF02041884    LBMM01006977    KMQ90149.1    GGMR01006838    MBY19457.1    ABLF02013358    ABLF02013361    ABLF02054869    GFXV01002090    MBW13895.1    ABLF02034925    GFXV01003903    MBW15708.1    GAKP01002292    JAC56660.1    GALA01001777    JAA93075.1    GALA01000302    JAA94550.1    KU543679    AMS38363.1    GALA01001776    JAA93076.1    AB593325    BAK38646.1    GGFJ01001370    MBW50511.1    KQ971388    KYB24913.1    GGFJ01001369    MBW50510.1    GGMR01019493    MBY32112.1    AB593321    BAK38639.1    ABLF02023257    GGFJ01001439    MBW50580.1    GGFL01004044    MBW68222.1    GAMC01020519    GAMC01020515    JAB86040.1    GAMC01020517    JAB86038.1    AB090822    BAC57920.1    KU543683    AMS38371.1    ABLF02007989    KQ972691    KXZ75806.1    ABLF02027248    KQ971310    KYB29500.1    KYB29499.1    ABLF02041557    GGFJ01001453    MBW50594.1    GGFJ01001454    MBW50595.1    KQ972544    KXZ75869.1    GGFK01005660    MBW38981.1    ABLF02011927    KXZ75807.1    ABLF02014650    AB593326    BAK38647.1    ABLF02004854    ABLF02041317    ABLF02030663    ABLF02041312    ABLF02018808    AB090815    BAC57906.1    ABLF02020969    GGFL01001192    MBW65370.1    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    GGMR01012748    MBY25367.1    GGFL01001190    MBW65368.1   
Pfam
PF03372   Exo_endo_phos        + More
PF00078   RVT_1
PF14529   Exo_endo_phos_2
PF01553   Acyltransferase
PF01421   Reprolysin
PF00098   zf-CCHC
PF12017   Tnp_P_element
PF00075   RNase_H
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR000663   Natr_peptide       
IPR021896   Transposase_37       
IPR012337   RNaseH-like_sf       
IPR002156   RNaseH_domain       
IPR036397   RNaseH_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D
PDB
1WDU     E-value=9.1805e-08,     Score=140

Ontologies

Topology

Length:
1303
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.552409999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.02551
outside
1  -  1303
 
 

Population Genetic Test Statistics

Pi
1.820265
Theta
0.706343
Tajima's D
2.765608
CLR
112.473285
CSRT
0.981300934953252
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号