SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16033  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA004550
Annotation
PREDICTED:_epidermal_growth_factor_receptor_kinase_substrate_8-like_isoform_X3_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.525
 

Sequence

CDS
ATGTCCGCGCAATTGGGCCGCGACAGAGAAAGAGAAAGGGATAGAGACAGAGACCGTAGCGGCTCTGGGGGCGAAAGAGACGACGCTTCATCCACAGGCTCCGAGCGTCTATACGAACAAGACATCGCCATATTGAACCGTTGCTTCGACGACATAGAGAAGTTCATAGCAAGATTACAGCATGCGGCTGCAGCTTCAAGGGAGTTGGAGAGGAGGAGAAGATCGCGAGGAGGCAAGCGAGCGGCGGCTGGTGAAGGAATGCTCGCAATGAGAACCCGTCCTCCGCCGGAGCGCGATTTTGTCGATGTCCTGCAGAAATTTAAACTGTCCTTCAATCTGTTGGCACGTTTGAGAGCTCACATCCATGACCCCAATGCTCCGGAGTTGGTTCATTTCTTGTTCACACCGCTGGCGCTTATTGTGGACGCAGCACAGGACGTCGCCGACGGCCGTCTTCCAGCTAGGGTTGTGCAACCTCTCCTCACGAGGGAGGCCTTGAACCTTCTGGCGAATTGCGTGACAAGCAAAGAAACTGAACTGTGGCACTCATTAGGAGACGCTTGGCTGATACCCAGGGAGCAATGGAAAACACAGATACCACCATATCAACCGGTTTTCATGGACGGGTGGACTCCAGATTACCAAGTCGATGACCAACCTTTACGCAGGTCATCGCCCAGACGCAGCGAGCTGGGCAGGGGTACAATGGAACGGGGCGTGGAAAGGAGCGAGGGCGGGCAGGTGGCGGGTTTCACGTTCGAACGAGAGGAGCCCGAGATATACAACGAGCAATACGCTCCGTTCGCCAGAAATAACTTGAGACCACCAATCGGCCGCGAAGATTCGGGCTCCGCTGCCTCATCGCCCGACAGAGAGCCCCCGTATCGCCCCGCAGACCGAGATGAAGATCTGGGTGAAGCGTGGGCCCGGGGCGTTGCGGCCCGGGGAGGTCGCGTTGTGCGCGTCACCTACCCTCGCACTGCGAATAACGATAAAGAGTTAACTGTCGTGAGGGGAGAGTATTTAGAGGTTCTAGACGATTCGAGAAAGTGGTGGAAGGCTCGTAACAGACGCGGCGTGTCAGCGCACGTGCCACACACCATCGTGGCTCCCGCGTTTTCGCCGCCTTCGTCACCACACCTATACCCTAATCCGATATACACACATTACCAGGATGGCGGGGGGAGAGCTTCGGGCGGCAGCAGTCCCACAGCGGCACCGGAGAAACCAGCGCCAAAGATTGAGGCGGCTGCTCCACCGCCCCCGCCGCCGCCTCCTCCACCCCCGGAGCCGCCGTCACCGCCACCCATCAAATCTGATACTTTGAAATCCACCAAATCGATAATGAGTACTGGCGGCAGTCTCCACGATGAACTGAAGCTAGTACTGCCCCAGATACAGCAAAGAAGAAACAAACTCGACATCAAGAAGACTCCAGATATATTCATTGATCAGAAATCGAATCCGGACGAGGTTGTGGAATGGCTCGAAGCAAAGGGTTTCAGCAATGCCGCCCAACGCCAGCTGAGGATGTCGGGACACCAGCTATTCGCGCTGTCCAGATCTCAGCTGGAGAGGGCACTGGGCCAGGATGAGGGGAAACGACTGTACAGCCAAATTTTGGTCCAGAGGAACGTGTCTGGGTACAAGACGACCTCGGCATCAGAGCTTCAGAGCATCCTGAGGAAAGTACGAGAGAAAGTCGAAGTCTCATGA
Protein
MSAQLGRDRERERDRDRDRSGSGGERDDASSTGSERLYEQDIAILNRCFDDIEKFIARLQHAAAASRELERRRRSRGGKRAAAGEGMLAMRTRPPPERDFVDVLQKFKLSFNLLARLRAHIHDPNAPELVHFLFTPLALIVDAAQDVADGRLPARVVQPLLTREALNLLANCVTSKETELWHSLGDAWLIPREQWKTQIPPYQPVFMDGWTPDYQVDDQPLRRSSPRRSELGRGTMERGVERSEGGQVAGFTFEREEPEIYNEQYAPFARNNLRPPIGREDSGSAASSPDREPPYRPADRDEDLGEAWARGVAARGGRVVRVTYPRTANNDKELTVVRGEYLEVLDDSRKWWKARNRRGVSAHVPHTIVAPAFSPPSSPHLYPNPIYTHYQDGGGRASGGSSPTAAPEKPAPKIEAAAPPPPPPPPPPPEPPSPPPIKSDTLKSTKSIMSTGGSLHDELKLVLPQIQQRRNKLDIKKTPDIFIDQKSNPDEVVEWLEAKGFSNAAQRQLRMSGHQLFALSRSQLERALGQDEGKRLYSQILVQRNVSGYKTTSASELQSILRKVREKVEVS

Summary

Pfam
PF18016   SAM_3        + More
PF08416   PTB
PF00018   SH3_1
Interpro
IPR011993   PH-like_dom_sf        + More
IPR033928   EPS8_PTB       
IPR013761   SAM/pointed_sf       
IPR039801   EPS8-like       
IPR041418   SAM_3       
IPR013625   PTB       
IPR001452   SH3_domain       
IPR035462   Eps8_SH3       
IPR036028   SH3-like_dom_sf       
SUPFAM
SSF50044   SSF50044        + More
SSF47769   SSF47769       
Gene 3D
PDB
1WXB     E-value=1.20268e-07,     Score=136

Ontologies

Topology

Length:
571
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00644
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00180
outside
1  -  571
 
 

Population Genetic Test Statistics

Pi
359.008973
Theta
181.316389
Tajima's D
2.773282
CLR
0.234532
CSRT
0.966351682415879
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号