SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16033  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA004550
Annotation
PREDICTED:_epidermal_growth_factor_receptor_kinase_substrate_8-like_isoform_X3_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.525
 

Sequence

CDS
ATGTCCGCGCAATTGGGCCGCGACAGAGAAAGAGAAAGGGATAGAGACAGAGACCGTAGCGGCTCTGGGGGCGAAAGAGACGACGCTTCATCCACAGGCTCCGAGCGTCTATACGAACAAGACATCGCCATATTGAACCGTTGCTTCGACGACATAGAGAAGTTCATAGCAAGATTACAGCATGCGGCTGCAGCTTCAAGGGAGTTGGAGAGGAGGAGAAGATCGCGAGGAGGCAAGCGAGCGGCGGCTGGTGAAGGAATGCTCGCAATGAGAACCCGTCCTCCGCCGGAGCGCGATTTTGTCGATGTCCTGCAGAAATTTAAACTGTCCTTCAATCTGTTGGCACGTTTGAGAGCTCACATCCATGACCCCAATGCTCCGGAGTTGGTTCATTTCTTGTTCACACCGCTGGCGCTTATTGTGGACGCAGCACAGGACGTCGCCGACGGCCGTCTTCCAGCTAGGGTTGTGCAACCTCTCCTCACGAGGGAGGCCTTGAACCTTCTGGCGAATTGCGTGACAAGCAAAGAAACTGAACTGTGGCACTCATTAGGAGACGCTTGGCTGATACCCAGGGAGCAATGGAAAACACAGATACCACCATATCAACCGGTTTTCATGGACGGGTGGACTCCAGATTACCAAGTCGATGACCAACCTTTACGCAGGTCATCGCCCAGACGCAGCGAGCTGGGCAGGGGTACAATGGAACGGGGCGTGGAAAGGAGCGAGGGCGGGCAGGTGGCGGGTTTCACGTTCGAACGAGAGGAGCCCGAGATATACAACGAGCAATACGCTCCGTTCGCCAGAAATAACTTGAGACCACCAATCGGCCGCGAAGATTCGGGCTCCGCTGCCTCATCGCCCGACAGAGAGCCCCCGTATCGCCCCGCAGACCGAGATGAAGATCTGGGTGAAGCGTGGGCCCGGGGCGTTGCGGCCCGGGGAGGTCGCGTTGTGCGCGTCACCTACCCTCGCACTGCGAATAACGATAAAGAGTTAACTGTCGTGAGGGGAGAGTATTTAGAGGTTCTAGACGATTCGAGAAAGTGGTGGAAGGCTCGTAACAGACGCGGCGTGTCAGCGCACGTGCCACACACCATCGTGGCTCCCGCGTTTTCGCCGCCTTCGTCACCACACCTATACCCTAATCCGATATACACACATTACCAGGATGGCGGGGGGAGAGCTTCGGGCGGCAGCAGTCCCACAGCGGCACCGGAGAAACCAGCGCCAAAGATTGAGGCGGCTGCTCCACCGCCCCCGCCGCCGCCTCCTCCACCCCCGGAGCCGCCGTCACCGCCACCCATCAAATCTGATACTTTGAAATCCACCAAATCGATAATGAGTACTGGCGGCAGTCTCCACGATGAACTGAAGCTAGTACTGCCCCAGATACAGCAAAGAAGAAACAAACTCGACATCAAGAAGACTCCAGATATATTCATTGATCAGAAATCGAATCCGGACGAGGTTGTGGAATGGCTCGAAGCAAAGGGTTTCAGCAATGCCGCCCAACGCCAGCTGAGGATGTCGGGACACCAGCTATTCGCGCTGTCCAGATCTCAGCTGGAGAGGGCACTGGGCCAGGATGAGGGGAAACGACTGTACAGCCAAATTTTGGTCCAGAGGAACGTGTCTGGGTACAAGACGACCTCGGCATCAGAGCTTCAGAGCATCCTGAGGAAAGTACGAGAGAAAGTCGAAGTCTCATGA
Protein
MSAQLGRDRERERDRDRDRSGSGGERDDASSTGSERLYEQDIAILNRCFDDIEKFIARLQHAAAASRELERRRRSRGGKRAAAGEGMLAMRTRPPPERDFVDVLQKFKLSFNLLARLRAHIHDPNAPELVHFLFTPLALIVDAAQDVADGRLPARVVQPLLTREALNLLANCVTSKETELWHSLGDAWLIPREQWKTQIPPYQPVFMDGWTPDYQVDDQPLRRSSPRRSELGRGTMERGVERSEGGQVAGFTFEREEPEIYNEQYAPFARNNLRPPIGREDSGSAASSPDREPPYRPADRDEDLGEAWARGVAARGGRVVRVTYPRTANNDKELTVVRGEYLEVLDDSRKWWKARNRRGVSAHVPHTIVAPAFSPPSSPHLYPNPIYTHYQDGGGRASGGSSPTAAPEKPAPKIEAAAPPPPPPPPPPPEPPSPPPIKSDTLKSTKSIMSTGGSLHDELKLVLPQIQQRRNKLDIKKTPDIFIDQKSNPDEVVEWLEAKGFSNAAQRQLRMSGHQLFALSRSQLERALGQDEGKRLYSQILVQRNVSGYKTTSASELQSILRKVREKVEVS

Summary