SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16030
Pre Gene Modal
BGIBMGA004549
Annotation
PREDICTED:_uncharacterized_protein_LOC101735730_isoform_X3_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.255
 

Sequence

CDS
ATGGCCGCACACCAAGATTCTATCCATGAGAGACTTCAACCGGCACCAGAAGAACCGCTATATCTCCGCCATGGAACGCCAACTTGGCCCGAAGCTAATGACAACCAAGAAGATCACAGCGCCGACTTATCTCCGTACTACAACATGCCCAAACGGAACAAAAGAAAGAACTTCAAGCCTCGATGCGCTCCTAACACCTCAGCATTTTCTGATGACTCGAACGAAGGCAACTGCGAGGACACGAGGAGTTCAATCAACGGAAATGAGAGAACTACTCCTGAACACATAGAAGATGACAAAGAAGACGGAGGCTACGCTAAAATCGGCGTGAAGAACTTTAATCTATTGAAAGGAGGTGCTGTAGATCTCAGTAGAAGATTAAGCACAGATTCAAATGAGAATATAGAATCGAATTACCAAGACAGGTTAACAGAAAACAAAAAGGTAGATTCTTTTCAGAGAACCTACATCCACAGCCTTCAGATGACCCAAGCTAGTGAAAACGATAGGACCGTGTTAAACTTTAGTAATTTACAAAACAAAACATTTTGTGCCAAAAATCCTTTTGCTATATCACAACTAATCAAAACAAACTCTCCGCCGAGGAGAAGGGACTCTGATTCCGATGAAGACAAAGGGCAGGATATAAACGCTAATGAAAGGTTAGAAAATCAAGAGTCGATAGAAACCGATGCCCAATCTAATGGAGACACGAACAATGCTACAAACAGAATCTTGAGAGATTACGCTATGAATACAATGAAGGAATTACTCGGGATTTACGGTTTATCTTCTAATGAAGTCGCTGAGGCCATAAGTGGGCAGATAAGGGCTTTAGAAGCACTTCAAGGTAAACCTTTCACCCAACTACCGCTTAGTTTGAAGAGGCGCCACGACTCAACACTGGAAGACGGCACCGAAAGAAGTATCAGAAGATCCTCGTCGGCTACCGAGGATGAGGACTCTACGAATATTACACCACCGAAGACACCAGATAACGAATTGCAAGCACAAAGACAAAGAGCTTTACAAATAATCAACCAACAATCAATGAGGCTGTTTAATAGATCTCAGGCCCAGGAGGAAGACGGCAGCGGATCTGATGACGGAGACCAGACCCTCGATTTGAGTGTGTCCAGGGACACAGATGGACAAGAACAGTCCACAACGTCGAGCGCGGGAAACAGTGTATCAGAGTTCGAGCAGCAAAACATGCTGATGAGGAAGAATCTCGAAGATTTGGCCAATCTGCAGATGCAGGGCTACTTCCAGAAGCAATCGTTGGACGCTGATGATTCGCAAGAAAGAAAACTTCAAGCCAGTGGTCTTTTAAGCGCGCTGAATCATTTGGACCAAGCCCGAAAGAACTCTTTGCAGACGACCGTAGATTACTCTAGATACGTTAAGAGGTATGGATCAACATTGGAATGCGGCTCATCGTATTGCAAAGATCTCGGTTACCGAGAGCATTTCCATTGCATGGACTGCACTGCTCGGGTTTTCTGCAAGAAAGAAGAGATGATACGGCATTTTAAGTGGCACAAGAAACGGGACGAATCTTTAGCGCACGGCTTCATGAGGTATTCTCCGCTGGACGATTGCTCGGAGCGATTCGCCGATTGTCCACACAACAGAAGCCAAACGCATTACCATTGCATACAAGACGGCTGTGATAAGGTGTACATCTCGACGTCAGACGTGCAGATGCATGCGAACTACCACAGAAAGGACACTGCGATCCTCCAGGAAGGCTTCCAGAGGTTCAGAGCAACCGAGAGCTGCACGGCCTCTCACTGCATCTTCGCCGGGCAGAGGACCACACATTTCCACTGCAGGAGACCTGGATGCACTTACACTTTCAAGAATAAAGCGGATATGGAGAAACACAAGACGTACCACATCAAAGACGAAGCTCTGTCCAAAGACGGCTTCAAGAAGTACATGAAGAACGAGGCGTGTCCGTACCGGGACTGCCGGTTCAGCCGGACCTGCAACCACATACACTGCATCCGCCCGCACTGCAACTACGTCCTGCATTCCAGCAGCCAGATCTTTACACACAAGAGGAAACACGAGAGGAAGGAACAAGAAATGAGCTTCGGACTGCCGACGTCGGTCATCCAATCGGCTTTGATGCAGCAAGGAGCTGACCTCAGCCTGTACTCCCCCGGGAATCTACACATCGACGATGACATCTCCAATCAGATCATGGACTCGGATTACTCGCTTCCTTTCAACCCCGCAATAGTCGAGGAGGTATCCAGGAAGTTCATTGAGACGTTCACCGGGGGCAAGGATGCTGACGATAAGTGCACCAAGTGTAGCGCCTTCAACAAGCACTACCATTGCGCGGCGGACGGATGCAAGATGGCGCACAGTTGTCACACGACGATGGTGAAGCACGCAATGGAACACGAACAACAGAACCAGGTGACCGAGGCGTACTTCGTGATGTACTCGAGGAGCAGTCCGTGCGGGAACTCGGCCTGTCAGCACATCCGGGATATCACGCACTACCACTGCACTTGGGAAAATTGCGGTGCAGTAATCTTGTCGTCCGAAGAGCATCCATTCAGAAGACTAGAACACCACCGTCAGCATGCGATTCTCAGCCCAATGTCCCCTAACTTAGCGGCTAGATTCGCTCCCAACTTCACACCTCAACTAACTGCTCAACTACATCCGAACATGGCTGCCCAGCTCGGCCAAGTTCCAAGTTTGCCAAATCTCCCTCCGAACTTGGCTCAATTGGCCCAAATGGCGCCGAGCCTTGGACCGCAGCTGACACCAAACCTGCAGGCGCAACTTAACCTTGGGCCCAATCCCGGAGTGGTGCCTCAGCAAGTCAATCCCTCAAGTTCCCTGGACGAAATGTTTAGTAGGAAGCGAGGAAGGCCGCCGAAGAATAGAGTTGTCGAAGTCTGGACTGACAATATAACACCTCAAGCGATATTCACGTCATTCAAGCTCCCTAAAAGCAATCAGATGCCTTCGGTTATACCGTCGCCCATCATCGCCACGGTCGAAGAATTTCCGCGCATCAAATTCCACCATTTCGAGGTGTTCACGAATTTGGACGGCTGCAGCCAATATTACCCTAACTGTCAACTGAGAATGACCAGGATCCACTTGCATTGTTTCAACTGCAGCTTCTCTGGCGAAACCTACTCCATCATGGAGACGCACATGCGAGAATCTCACTCGATCTCCCCCCTAATTGACGGATTCGATCACTTTCCCTCGTTTGACCATTGCGGTGGGAAAAGCTGCTTCAAGAACCAGTTGCGGTCCCACTTCCATTGCGCCCAAGGGAACAATTGCCCGGCTATCATAACTCAGTACTCCGTGCTGGCAACGCATAAGCACGGACGCGGCACTCCTGTCATCAAGAGTGAATCCGAACAAGATAAATCTTTCGAAGAAGCCAGAGATTACTCTTTAAAAGAGAGAGCGTCAGTGGACAGTGTAGGTTCGACGAAAGAGGCCGATATATACGCAGCAACGAATTTCACAATCAAAAGCGAATTCGAAAGGGAACAAGATAACGTTTCTGTAAAAGCGACGGGCACGTTTTACCCGTCGTCACATTTAAGAAGCAACGCTTCCTCTCCATCCCCGAGGAGCATCTACGATGCGTCTCCATCGAAAGACCTCAAGCCTCGCGTAGACTTTGAGAAGAAGGCCTTCGAACCTCACAAGAGTACGGGACCGACTATACCACCCTCGTGCCACGACCAGACCTGTCCTTTGAACAAGTCTGCTGGAGGGATGAACCTCCACTATCACTGTCCTCATTGTAGTCAGGCGTATGTAGACCTGAAGCTACTGTTCAGTCATATGATGAAGAAGCACAGTAACAACGAGTCAGCGCCCGCCGGATTGGCAGCCACTAAGGAGACGTTGGAGAGGGAGTATCCTGAAATATCGATTCTGCCCTCGACGGCTTCTTCATCAGCAAGCCAGGCCCCTTCACCCAGCCAGAGACAACCCAACCCTGCTGATCAGGTCCAAGCTGTCCACAGTCTCCTCCTGCAGCAGTACCTAGCCGGGGGCCGGAAGGGCAGTCTCCAGGACCAGCTAAAGATGCAGCAGCAGTACACAGCCTCCCTGGCGGGCTTGCCGGGCCTGGCTCAAGTGGCCCTCTTCTCTCAGGGCGGGCCTCCGTTCCCGCTTTACCCAACGATGCTGTACCCACCGGATCTGCTACTTGAGCAAAGCCTCATTCAGGGACACGGCCTGCCTCCCGGGATGGACAAGGAAGCCGAAATGATCGCTAAATCTCGTAGGACGCACACGGCCCGCGGTCCACACATGCGTGTCCTGAAGGACGAGCCCATCCCCGAAGGCTACCTGCGATTCAGATTCAATGAGGACTGCGCTTATCAAAACTGCGGATACAGGGAACATCAAACTCACTTCCACTGCACTCGCAAGGACTGCGGATATTCCTTCTGTGACAAGACCAGATTCGTGCAGCACACCGCCAGACATGAGCGATTGGACACGTTGATGGGAGGTGATTTCCAGCAATACAGAGCCAACGTCTATTGCCAGAGGCCAGAGTGTCCGCATGCTTCCACGTTCGGCCAGAACAAGGCATCGCATTTCCACTGTCTCAAGTGCGACTTCGTTTGCACGGACACAAACAAAGTGGTCGCTCATCGTCGCCAGCACCAGAAGCTCGATTCCATTCAAGCGGCAGGCTTCGAGAAATTTCCGCCCAGCAAAGGTTGTGGATACGAACCGCAATGTATTCACAGTAAGAAGCAAACCCACTATCACTGTCTTCAGTGCGGTTTCGCTGTGCTTGGCCTCTCCCAGATGACGTCACACAAGTACAAACATCAAGAAGCAAATCTAGGACCCTCGACCAGCGGCACCAACTGA
Protein
MAAHQDSIHERLQPAPEEPLYLRHGTPTWPEANDNQEDHSADLSPYYNMPKRNKRKNFKPRCAPNTSAFSDDSNEGNCEDTRSSINGNERTTPEHIEDDKEDGGYAKIGVKNFNLLKGGAVDLSRRLSTDSNENIESNYQDRLTENKKVDSFQRTYIHSLQMTQASENDRTVLNFSNLQNKTFCAKNPFAISQLIKTNSPPRRRDSDSDEDKGQDINANERLENQESIETDAQSNGDTNNATNRILRDYAMNTMKELLGIYGLSSNEVAEAISGQIRALEALQGKPFTQLPLSLKRRHDSTLEDGTERSIRRSSSATEDEDSTNITPPKTPDNELQAQRQRALQIINQQSMRLFNRSQAQEEDGSGSDDGDQTLDLSVSRDTDGQEQSTTSSAGNSVSEFEQQNMLMRKNLEDLANLQMQGYFQKQSLDADDSQERKLQASGLLSALNHLDQARKNSLQTTVDYSRYVKRYGSTLECGSSYCKDLGYREHFHCMDCTARVFCKKEEMIRHFKWHKKRDESLAHGFMRYSPLDDCSERFADCPHNRSQTHYHCIQDGCDKVYISTSDVQMHANYHRKDTAILQEGFQRFRATESCTASHCIFAGQRTTHFHCRRPGCTYTFKNKADMEKHKTYHIKDEALSKDGFKKYMKNEACPYRDCRFSRTCNHIHCIRPHCNYVLHSSSQIFTHKRKHERKEQEMSFGLPTSVIQSALMQQGADLSLYSPGNLHIDDDISNQIMDSDYSLPFNPAIVEEVSRKFIETFTGGKDADDKCTKCSAFNKHYHCAADGCKMAHSCHTTMVKHAMEHEQQNQVTEAYFVMYSRSSPCGNSACQHIRDITHYHCTWENCGAVILSSEEHPFRRLEHHRQHAILSPMSPNLAARFAPNFTPQLTAQLHPNMAAQLGQVPSLPNLPPNLAQLAQMAPSLGPQLTPNLQAQLNLGPNPGVVPQQVNPSSSLDEMFSRKRGRPPKNRVVEVWTDNITPQAIFTSFKLPKSNQMPSVIPSPIIATVEEFPRIKFHHFEVFTNLDGCSQYYPNCQLRMTRIHLHCFNCSFSGETYSIMETHMRESHSISPLIDGFDHFPSFDHCGGKSCFKNQLRSHFHCAQGNNCPAIITQYSVLATHKHGRGTPVIKSESEQDKSFEEARDYSLKERASVDSVGSTKEADIYAATNFTIKSEFEREQDNVSVKATGTFYPSSHLRSNASSPSPRSIYDASPSKDLKPRVDFEKKAFEPHKSTGPTIPPSCHDQTCPLNKSAGGMNLHYHCPHCSQAYVDLKLLFSHMMKKHSNNESAPAGLAATKETLEREYPEISILPSTASSSASQAPSPSQRQPNPADQVQAVHSLLLQQYLAGGRKGSLQDQLKMQQQYTASLAGLPGLAQVALFSQGGPPFPLYPTMLYPPDLLLEQSLIQGHGLPPGMDKEAEMIAKSRRTHTARGPHMRVLKDEPIPEGYLRFRFNEDCAYQNCGYREHQTHFHCTRKDCGYSFCDKTRFVQHTARHERLDTLMGGDFQQYRANVYCQRPECPHASTFGQNKASHFHCLKCDFVCTDTNKVVAHRRQHQKLDSIQAAGFEKFPPSKGCGYEPQCIHSKKQTHYHCLQCGFAVLGLSQMTSHKYKHQEANLGPSTSGTN

Summary

Interpro
IPR013087   Znf_C2H2_type        + More
IPR040373   CASZ1       
IPR017956   AT_hook_DNA-bd_motif       

Ontologies

Topology

Length:
1628
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00356
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00010
outside
1  -  1628
 
 

Population Genetic Test Statistics

Pi
310.786608
Theta
185.33742
Tajima's D
1.57629
CLR
10.817591
CSRT
0.796910154492275
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号