SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16025
Pre Gene Modal
BGIBMGA004545
Annotation
PREDICTED:_transcriptional_activator_cubitus_interruptus_[Bombyx_mori]
Transcription factor
Location in the cell
Nuclear   Reliability : 4.074
 

Sequence

CDS
ATGTGGCAACCAGAATCCACAGATATCAATCACCATGTAAATACCGTCACCCATCTTGAGACGCAAGGCTTGGAGTACTTAAGTGCAGCAAGGAGCTTACACCCAGAGCTTCATGCCGGAAGCACGCTCGCGAGCCAAGACTTTCAACTTAGTTTAGATGGTTCTAGAATAGCGTCTCCAACGAGATTAAGGTTATCGGGCGGTGCAATCGGCGCTTCTGCGAATCGAAAACGGGCAGTTTCGTGGAGTCCGTATTCTGCGGAATCTCTAGACTTAGCTGCTGTGATCAGGGCGTCTCCAGCTAGTTTGGCAGTAAGAGCGCCGTCCGCTGCTTCCACAGGAAGCTATGGACATCTTAGTGCAGGAGCGATATCTCCAGCCCTTTCCCTCTCCCATGCTTCGTTGGCCCAACAATTGCTGGCTAGAGGAGGAGTGGTGGGAAGCAGTGGAGTACTGGCCGGAGGTGTACTGCTAGATCCTGCGCATCAACAGGCGGCCGCAGCTGCTGCTCATCATGCTGCTCATGCCCATTTGGTAGCTGGCATTCATAGATCTCACATATCGTCACCGACACAATTGCTCATGGGTCCTGTGGATGTCAGACAGGGCTTGGGACTAGACGGAACTCCCCCTCAGCACCTCCAGCAGCCTTCGCAGCAACCTGAAATCACTAGTGTTATGGAAGCTGATAGTGCTACAGGGCTGATGCAGCGCAAGTCGCCTCAGGGTATTCTCACGCACCGAGATAACGTGAGCAATAAGCCGCTCTCGGCCGCCGCGGAGAGCACAGTCCACGACGGTCTCGACTCCAAAGACGAGCCAGGAGATTTTATCGAAACCAATTGTCATTGGGTGGACTGCAAGCTTGAATTTCCCACTCAAGATGATTTAGTGAAGCATATTAATACGGACCACATACACGCCAGCAAGAAGGCGTTCGTCTGCCGCTGGGTCGGCTGTTCCAGAGACGAAAAGCCTTTCAAAGCCCAATACATGCTTGTCGTTCACATGAGGAGGCACACTGGAGAGAAACCTCATAAGTGCACTTTCGAAGGCTGCTGCAAAGCGTACTCCAGGCTGGAAAACCTGAAGACCCACCTCCGGTCGCACACTGGAGAGAAACCGTACACCTGCGAGTATCCGGGGTGCGCTAAAGCTTTCTCCAACGCGAGCGACAGAGCTAAACATCAAAACAGAACGCACAGCAATGAGAAACCGTACGTCTGTAAAGCGCCGGGCTGCACCAAGAGGTACACCGACCCCTCCTCGCTCCGGAAACACGTGAAAACCGTTCACGGAGCCGAGTTCTACGCGAGTAAGAAACATAAGGGTTGCACGAGAGGTGACGACTCCGCGGAGTCTGGCGGTGGTGGCGCAGGGTCGTCTCCTCGTTCGGAGGAAGGCGGAGTACCACCCGCGATCCGGGGTCACACATCATCGGCGTCCGTCAAGAGCGAGAGTCCCGCGTCGCCCATACCGCACGGCTTGCACACTTCCGCCCACCAGTTGTCTGCGCAATGCGGTGGGGAGCTGGACTTCGGCGGTGGTCTGGGAGGATACCGGGATGAAAACGGCCTGCCGTACTTTAGATTAGACGGAGAGATCGAGCAGGAAGTGGTCGGTGAAGTGGGACAGTTGCCGCTGATGCTGCGAGCTATGGTCGCTATCGGCGAGCCCCGCGCCGCCCCGCACGCCCCCCGCCTCGGGAACAAGATGGCGCTCGCGAGGATGCCGCCGCCACACGCCGACCTCGGAGGAGGCGGAGTCACGGGGAGGACAGAGCTGGGTAGCACCAATGTTGGGGTGGAATTGAAGACTGGGGCCTCTAACACGAGGCGCGATTCTGGAATCTCATCGGGCAGCAGCCTCTACAGCGCCAGGTCTTCGGATATATCGCGTAAAAGCAGTCAAGCATCAGTTGTGTCGGGAGCAGTGGTAGGAGGAGTCGGGGCGCAACGTCTAGTCGCGCACCACACCGCGGCGTACGACCAGCTCTCTCCCGACAGCAGTCGAAGATCTAGTCAAGTTTCGTGTGCGGGATACGCGCCTCCGCCCTCATCAGCCCTGGCCGCTGTGCAGGCCGTCAGGACATCGCAAGGGAATCAGGCCATCCTACTCCGGGGAGTCACATGTTCTGAAGTCAGGGCAGAGGAACTAGCGTTGGAGTTGGATCCGAACGTTCAAGTGAAAGAAGAGGCGAGAAGACTCTCGGAGCAGTCGAACTTAAGTGATCAGACCCAAGGCTACCAGCCGTACCCTTGCGGAACCGACGGTTTGGGCGACGCTCCGTTCCCGTTCAAAACTGAATGCGACCAGGAAACTGTGACGTATAAGGAGTCACGGTCCAATTCCACCAGCACCGTGGTGGTCACCACGGCACAGATCCACCACCCCAACCAGGAAGTCAACTTGGAACAGGTGGCTGAAGGTGAAATGGTGGAGAATAAGCTGGTGATACCCGACGAAATGATGCAATATCTTAACCAATCAATATTGGCAACCGAAGCGGAAACATCAGCTAAAACGGACTCCGCAAATCGACCTAACACAGAACCGAGTCTAGATAAGGACAGTGCTACCAAAGACAATACCACAAACGAACAACAAAACACTAATAATTCCAGTGATAAAATCAGTGACGTAGCGACCAGTGACGATTCTCTACTTAAAAATCTAGGTGCCATAGGAAGTGATCTCAATATAAGTGATATTCAAGTCGATTTAAGGTCGTTAGACGTTAGTATGTCGGGCAACAGCGGCTCTCTTCTGGCTGTCAAAACACCCGAAGATAAAACTCCTCTACAAGAACAAGTCACCCCGGAAGTCAAAGCAGAGAACAAAGAAAGGGAAACGAAGAAATCGGATCCGAATCCGTTGCAATCACTGCAAACGATGACAGCCAACCAGACTGAACAATCCAATAAAATTAGGGCTAATGCTCAGAAACAGAATAAGACGAATACTAAGACTATAATGAGTCAAAATATTTTGAGTCCGCAGAACCTGCCTCACAGCATGTTGAGTCCACAAAGCCTCCCGCACAGTGCAATGAGTCCACAAAGCGTTATGAGTCCGCACAATATCCCACAAAATATTATGTCCCCTCCCAGTGCTTATAACGTGATGAGCCCCCAAAGTGCGATGAGTGTAATGTCCCCGCAGCATAATGCCATGAGCCCACAAAGCATGCAAAGTCTCATGAGTCCACAGATACCCAACCAAATAATGTTGAGCCCTCGTCACAATAACGTCAGTAGCCCCATGTCACAGAATATGGCTAGTCCCATGATGAACATGGCTAGTCCGATGGGACAGACCATAGCCAGTCCCATGAGCCACGGTATGCCCAGCCCCATGCATCCAGGAATGCAAAGCCCAATGGGACAGGGCATGGCAAGTCCAATGATACAAAACATGCCGGTGGCTATGAACGGACCTGTGAACCCCAATCTCCAAAATCAAATGATCAACGTTAATCAACAACAAATGGCTCTCAGCTATCGGCCCAACTGTCACAGAATGCCGGCCCGGCCAAATATGCCGATGCCGAACCAGTATACGCAAAATTACAACAACAACCAACCACCACAATATCCAATGCAAAACCAAAATGTTAACGTGCACCATCAAAACGTGCAAAATTATCAAATCATGCAATCTTACAACCAGAACCAAGCACCGACGGTCAATCAAATGGTTCAAAATCAGAACGTTCATTATCCGAACCAGCCTATGATCAACTACCAACAGATGAACTTCAACCAGAACAACCGTGCTCACCCGATGCAGTCGTCTAGATCGTCCATGATGAGCGTCGACAACAGCGGCAACATGACCCGGGGTGTCATGACCAGTTACTGCGACACGCAACACCAGTGCCCGCCCGCACAGACCAATCATTACAACCAGAATGTACAGTACCCTCAGCCGCCTCCATACAATGCCGTCGTCAATAACAACGTGATGGGACCTCCACCACCGAAGAACAATCACCAATACAACCAAGCTATGATGAACAATAACCAATATTACAATCACCAGAGGCCTTACAACCAATGGGACTATCCAGGCAATCAGTTCAACAAACACAATCCACAGAAGTCCACACCGAATTCCGTGAACATGTCGACGGGAAGCCAGAAACAAGTCAAGTGCAACCGGCTGACGAACTGCAACCAAATCAAGAACGACCAGGCCGATTGCAGCATGAACAGCCTGAGGAGCCAAAACAACCAGCCCAGCGAAGTCCAAGTCTGGGACATATCTCAGTCGCAAATCGAAGCGAACAACGGAAGACGGAAGACCCAAAACAATTCAATGAGACAGGAAACTTATCAGAGAACGCTGGAGTACGTCGAGAACTGTGAAAACTGGAAGAGTTCTGAAATGGTGTCGAGCACCACGCATCCCCTGCAAGGCGATAATATGGTTGTGAATGACCTCCAGACGTCTTTGTCTTCGTTTTACGAGGAGAATCAATACCTCCAAATGATTCAATAG
Protein
MWQPESTDINHHVNTVTHLETQGLEYLSAARSLHPELHAGSTLASQDFQLSLDGSRIASPTRLRLSGGAIGASANRKRAVSWSPYSAESLDLAAVIRASPASLAVRAPSAASTGSYGHLSAGAISPALSLSHASLAQQLLARGGVVGSSGVLAGGVLLDPAHQQAAAAAAHHAAHAHLVAGIHRSHISSPTQLLMGPVDVRQGLGLDGTPPQHLQQPSQQPEITSVMEADSATGLMQRKSPQGILTHRDNVSNKPLSAAAESTVHDGLDSKDEPGDFIETNCHWVDCKLEFPTQDDLVKHINTDHIHASKKAFVCRWVGCSRDEKPFKAQYMLVVHMRRHTGEKPHKCTFEGCCKAYSRLENLKTHLRSHTGEKPYTCEYPGCAKAFSNASDRAKHQNRTHSNEKPYVCKAPGCTKRYTDPSSLRKHVKTVHGAEFYASKKHKGCTRGDDSAESGGGGAGSSPRSEEGGVPPAIRGHTSSASVKSESPASPIPHGLHTSAHQLSAQCGGELDFGGGLGGYRDENGLPYFRLDGEIEQEVVGEVGQLPLMLRAMVAIGEPRAAPHAPRLGNKMALARMPPPHADLGGGGVTGRTELGSTNVGVELKTGASNTRRDSGISSGSSLYSARSSDISRKSSQASVVSGAVVGGVGAQRLVAHHTAAYDQLSPDSSRRSSQVSCAGYAPPPSSALAAVQAVRTSQGNQAILLRGVTCSEVRAEELALELDPNVQVKEEARRLSEQSNLSDQTQGYQPYPCGTDGLGDAPFPFKTECDQETVTYKESRSNSTSTVVVTTAQIHHPNQEVNLEQVAEGEMVENKLVIPDEMMQYLNQSILATEAETSAKTDSANRPNTEPSLDKDSATKDNTTNEQQNTNNSSDKISDVATSDDSLLKNLGAIGSDLNISDIQVDLRSLDVSMSGNSGSLLAVKTPEDKTPLQEQVTPEVKAENKERETKKSDPNPLQSLQTMTANQTEQSNKIRANAQKQNKTNTKTIMSQNILSPQNLPHSMLSPQSLPHSAMSPQSVMSPHNIPQNIMSPPSAYNVMSPQSAMSVMSPQHNAMSPQSMQSLMSPQIPNQIMLSPRHNNVSSPMSQNMASPMMNMASPMGQTIASPMSHGMPSPMHPGMQSPMGQGMASPMIQNMPVAMNGPVNPNLQNQMINVNQQQMALSYRPNCHRMPARPNMPMPNQYTQNYNNNQPPQYPMQNQNVNVHHQNVQNYQIMQSYNQNQAPTVNQMVQNQNVHYPNQPMINYQQMNFNQNNRAHPMQSSRSSMMSVDNSGNMTRGVMTSYCDTQHQCPPAQTNHYNQNVQYPQPPPYNAVVNNNVMGPPPPKNNHQYNQAMMNNNQYYNHQRPYNQWDYPGNQFNKHNPQKSTPNSVNMSTGSQKQVKCNRLTNCNQIKNDQADCSMNSLRSQNNQPSEVQVWDISQSQIEANNGRRKTQNNSMRQETYQRTLEYVENCENWKSSEMVSSTTHPLQGDNMVVNDLQTSLSSFYEENQYLQMIQ

Summary

Pfam
PF00096   zf-C2H2
Interpro
IPR036236   Znf_C2H2_sf        + More
IPR013087   Znf_C2H2_type       
SUPFAM
SSF57667   SSF57667       
PDB
2GLI     E-value=1.21053e-71,     Score=691

Ontologies

Topology

Length:
1499
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0396100000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00184
outside
1  -  1499
 
 

Population Genetic Test Statistics

Pi
303.409087
Theta
170.834599
Tajima's D
2.322702
CLR
0.217347
CSRT
0.927553622318884
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号