SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16023
Annotation
PREDICTED:_uncharacterized_protein_LOC105396011_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 3.007
 

Sequence

CDS
ATGGATGAACTTTTGAACGTTTTAGAAAATACCGCTGCGCTCTTAAGCAAAACTCAAATTAATTTAAAGAAATGTCCAAAAGCTAGATTGACAAGAGGTTATGTAGAAGCAAGAATCAAATGTATCGAAGAATATTGGACTACATTTAAGCAAACGCATCTACAATTGGTAAAAATAACACCGAAAGAACAAAGACAAGAGTTACCATATTTTCAAAATGAAGATTACTTCGTGTTCGAAGATTTGTATCTCGTTTTGTTAGCCGATTTAAAAGATCTTTTGCAATCTTTCACACAAGCAGCCGCGCCGAGTACTGTAACGTCCTCACCAAATAATTCTAAGATTATTGCGGATACCGAAAACCTTGTTCGGTTACCGAGAATCGAATTACCGAAATTCACTGGAAACTATGAAGATTGGCCTACGTTTCAAGACCTATTTACCTCCTTAGTGGATAAGAACCCGGCTTTAAGTGACGTACAAAAGTTACATTATCTTAAGAGTACAGTCAGCTGCGAGGCAGAAACATTATTAAAACCTGTTCAAGTCACGGAAAACAATTATAAAAAAGCATGGAACATTTTGAAGTCAAGGTATGGAAATAAAAGATTAATAATTAACTCAGTGTTGAAGAAATTATTTAATCAGAAGAAAATTAGTTCTCAGTCTGCAACTCAATTAAAAAATTTATTAGACGTCACGACAGATTGTTTGAATAATTTAGAAAATTTAAATATACCTACGACCTCCTGGGATCCTATAATTATATTCCTTGTGATACAGAAGTTGGACCCGGAGTCTCACAAAGAATGGGAGCAGACAGCTTATTCAAAATCAGAGGACGAACTACCAACTTGGGAGAATTTAAAAGATTTCCTGCAGTCAAGATACCGTACCTTAGAACTTGTATTGTCCGTGTCAGGGACTTGTAGCAGCCGTGACAAACCTGTAAGAGAACGTTCACACTTAGTAACTGCCACAGCCACCACGTCACAGCCAAATGAAAGAACTTGCGTGCTCTGTAAAGAAAAACATACATTATGTCATTGTAAGAATTTTACCAAACTGCAACCTAAAGAAAGAGCTGATTATGTCAAGACCAACAATCTGTGTTTTAACTGTTTGGTGCCTGGGCATTCTGCTTACCAGTGTAAGTTACAAATGTCCTGTCGCTTATGTAGAAGACGGCATCACACTCTTCTCCACCGCCATCAAGACTCGGCACAAACTGAGGAAAGGAATCAACCGAGTGCATCTCACCACGGGGTAAAAGAGAAAGAAGAGGTTATAAATAGCATGGTGGCGTCACATCACAGTACTAAGCAAAGCACAGCACTACTAGCCACAGCGATGGTTTTAACGAGGAACGAGCATAACCAAACCGTTGTTCTTCGTGCGCTAGTAGACCATGGTTCGCAGGCTTCATTTTTAAGCGAGAAGGCGGCTCAAATGCTCAAACTTACCAGGCAATCAGCGAGAGGAAGTATTATCGGGGTGGGATCTACAAGAACTAATGTTGATCACGTGGTTCAACTTAAGATTGGCTCCCGCTGGAATCCAAGCTTCGAAATCAACATACAAGCATATGTTATGAGTAAACAGTTGACCACGAAGATCCCCTCCAAAGCTGTAACTGTCACACATTGGCCACATCTAGAAGGACTCAACCTGGCAGATCCAGACTACTTCCAACCAGGTTCGATAGACTTACTTCTTGGTGTTAAAGAGTATGCACAAATTGTGCAACCAACACTTATTAAGGGCCCTCCAGGTTCTCCATGTGCCCAAGAAACCAACCTGGGGTGGATCCTCTTCGGAGAAATCGATAATAACCGTGAAAATGAATCATTTCTGGTCCTTCATCATCAAGTCCATATAGATCATATGTTGAAATCCCTCTGGGAAATTGACAATGATAAAAAGAGAATATTAACAAAGGAAGAAAAGCTATCGAAGGGCTCCAACTGCGTTTCTCTAAACGATGAATTGCTTGTAGGTCCACAACTGCAAGAAGACTTAAGGAACATACTTATGAGATCGAGATTACATCGTGTTTGCTATGCAAGTGATATACAAAAGATGTACCTGCAAATATTACTTTATGAAGAAGACGCCGATCGATATCAACGCCTTTTGTGGAGAGAGAATGATACAGACCCTATTAAAGAATATCGTATGCTTCGTGTTACATTTGGTACAGCGGCGGCTCCTCACCTGGCTGTAAGAACGCTTCACCAGGTGGCGGACGATGAAGGTCGAAATCACCCAATGGCTGTTCGAATTATTAAAGAAGATTTTTACATGGACGATCTAATGTCGGGGGAGAGCAGTGCTCCTGAAGCCATAAAAAGAGCACAAGAAGTAGATAATATTCTACAGAAAGGTGGATTTGTTTTATCAAAATGGTCATCCAATTCTGCTGAATTTTTGAAATCTATCGAACCAAACAAACGTACATCTCGAGCACAGTTGGATTTTAAATTGGATGGAAAAGTACAAGCTCTAGGTTTGATCTGGAACCTGGGCACGGATCAGTTTCAGTACAAGGTTAACTTACCAGCAAGGTCAAGCAGTATTACAAAGAGAGGCATACTATCTGATATTCAAAGACTTTTTGACCCACTGGGATGGATCGCCCCTAGCTTAATTTTGGCTAAGATTCTCATACAAAGGCTATGGCTAGAACCGATTGGCTGGGATGACGAGATTAACCAATCGCTGTTACACGATTGGCTGACAATTAGAGAAGACTTTGAACATGTAAAAGAGATAGGTATTCCAAGATGGCTAAACACAGTAAGCACACAGATGGAAAACATCGAGGTTCATGGTTTCAGCGATGCTTCCATGAAAGCCTATGCTGCGGTAGCTTACATTCGTGTAAAGAGGGAAGATGGTTCAGTATTCACCAATCTATTAGCTGCCCGTACTAGAGTGGCACCACTCCGTACCGTGTCTCTACCACGCCTGGAGTTATGTGGGGCGCTGTTATTAGCAAGGTTACTTAAGCAAATAGAAAATGCAATGCGTATACCTACTTCTAACATCTATGCATGGACAGATTCATCAATTGTTCTTGCATGGCTATCTGGTGATCCTCATAGATGGAAGACATTCGTGGCGAACCGGGTCGTAGAAATTGTAGAGAATGTAAACACACATCGATGGTTCCATGTAGCTTCGGAAGAGAATCCTGCAGACATCGGGTCGCGAGGCATGCTGCTGGCGGACTTGAAACAGAAAGAGTTGTGGTGGACAGGGCCCAAGTGGTTATGCAAAAAAGAAATAATATACAGTAAGCCAGGAATAACAGAAACAGAATTGGAAATGAAACCAATAAAATTAAATACTTACCACAATGCAGAAGAATTAAAACCTTTAACCGCTCAGTTTGAAGATTTTGATACGTTACCAGAATTACTAAAAACTATTATTTACTGTAAAAGATTTTTAAGACACAAAAGTAATTTAAGTACGAGCAAGGAAATAACTACACAAGAATTTGAAGAGGCGCTTATCACATGCATTAAGTTAGTACAACAAGAATTCAAAGAAGAAATAGATCGGCTAAGAGATAAGAAACAAGTTAGAAGAAAAAGTAAATTACGATCGCTAAACCCATACCTGGATGAGAATCATATCCTCAGGGTGGGCGGTCGCCTTAAACATACTAACTTACCTGATGACCGAAAACACCCAATTATTCTTGGAAATAACAACACCCTAGTACACTTGATCGTTGCTGACGCCCATATCAAGACACTACATGGAGGGGTTCAGTTAATGCTATGTTATCTCAGATCAAAATATTGGATCTTAAGGGCAAAATCAATAACAAAGAAACATGTACACCAATGTTTAATATGCGCCAGAATGAATGCTACTACAAGAACCCAACTAATGGGAGACTTACCGGAGCAGAGAGTAAACCCATCAAGACCATTTATAAACAGTGGGGTTGACTTTGCAGGGCCGTTTCACATCTTGATGTCGCGGTTCAGAGGATGTAAGACAGTCAAGGCCTACGTATGTATTTTCATCTGTATGGCTACTAAGGCGATCCACATTGAACTAGTTAGTGATCAAACTTCAGAAGCCTTCATCGGAGCTTTTAAGCGTTTTGTGTCCAGAAGAGGCAAATGCTGTCACCTCTGGAGTGACCAAGGTCGAAATTTTATAGGAGCTGATAAGGAACTGCAAGATGCCTGGAACGAGGCTCAATTACAGTTCCCCGGAAACATAGCAGAAAAGCTTGCTGCAGAAGGTACCCAATGGCATTTTATTCCGGCCTACAGTCCTACGTTTGGCGGATTATGGGAAGCGGGAGTTAAGTCTATAAAATTTCATTTAAAAAGGATCCTTAAAACTCACCTTACATTTGAAGAAATGAGCACCATTCTCTGCCAAGTGGAAGCTTGTTTAAATTCGAGACCGTTATGTCCGCTGGATGACACAGATATAGAAAATTTAAACCCATTGACACCCGGGCATTTCCTAATTGGAGAAGCTCCTATCGTCGTACCATCGCCTAACATGAAGGAGGTTCGGGTACATCATTTATCTAGATGGCAACATACACAAAAGCTGGTCAATGATTTTTGGCGGCGATGGCAGGACGAGTACTTATCCAGACTGCAGCAGCGTCCTAAGTGGCTAAGAAGAGAAGAGGAATTTAAAATTGGAGATATAGTCTTGATAAAAACAGATTACTTGCCGCCTGGAAAATGGTCTTTGGGAAGAATAGTCGAGAAGCACCCAGGTCCTGATAATCTCACGAGAGTTTACAGTGTGAAAAGTGGCAGTGCTGTGACAAAAAGATCAATAACAAAATTATGTTGTTTGCCGGTGGATTCCAATCAGTGA
Protein
MDELLNVLENTAALLSKTQINLKKCPKARLTRGYVEARIKCIEEYWTTFKQTHLQLVKITPKEQRQELPYFQNEDYFVFEDLYLVLLADLKDLLQSFTQAAAPSTVTSSPNNSKIIADTENLVRLPRIELPKFTGNYEDWPTFQDLFTSLVDKNPALSDVQKLHYLKSTVSCEAETLLKPVQVTENNYKKAWNILKSRYGNKRLIINSVLKKLFNQKKISSQSATQLKNLLDVTTDCLNNLENLNIPTTSWDPIIIFLVIQKLDPESHKEWEQTAYSKSEDELPTWENLKDFLQSRYRTLELVLSVSGTCSSRDKPVRERSHLVTATATTSQPNERTCVLCKEKHTLCHCKNFTKLQPKERADYVKTNNLCFNCLVPGHSAYQCKLQMSCRLCRRRHHTLLHRHQDSAQTEERNQPSASHHGVKEKEEVINSMVASHHSTKQSTALLATAMVLTRNEHNQTVVLRALVDHGSQASFLSEKAAQMLKLTRQSARGSIIGVGSTRTNVDHVVQLKIGSRWNPSFEINIQAYVMSKQLTTKIPSKAVTVTHWPHLEGLNLADPDYFQPGSIDLLLGVKEYAQIVQPTLIKGPPGSPCAQETNLGWILFGEIDNNRENESFLVLHHQVHIDHMLKSLWEIDNDKKRILTKEEKLSKGSNCVSLNDELLVGPQLQEDLRNILMRSRLHRVCYASDIQKMYLQILLYEEDADRYQRLLWRENDTDPIKEYRMLRVTFGTAAAPHLAVRTLHQVADDEGRNHPMAVRIIKEDFYMDDLMSGESSAPEAIKRAQEVDNILQKGGFVLSKWSSNSAEFLKSIEPNKRTSRAQLDFKLDGKVQALGLIWNLGTDQFQYKVNLPARSSSITKRGILSDIQRLFDPLGWIAPSLILAKILIQRLWLEPIGWDDEINQSLLHDWLTIREDFEHVKEIGIPRWLNTVSTQMENIEVHGFSDASMKAYAAVAYIRVKREDGSVFTNLLAARTRVAPLRTVSLPRLELCGALLLARLLKQIENAMRIPTSNIYAWTDSSIVLAWLSGDPHRWKTFVANRVVEIVENVNTHRWFHVASEENPADIGSRGMLLADLKQKELWWTGPKWLCKKEIIYSKPGITETELEMKPIKLNTYHNAEELKPLTAQFEDFDTLPELLKTIIYCKRFLRHKSNLSTSKEITTQEFEEALITCIKLVQQEFKEEIDRLRDKKQVRRKSKLRSLNPYLDENHILRVGGRLKHTNLPDDRKHPIILGNNNTLVHLIVADAHIKTLHGGVQLMLCYLRSKYWILRAKSITKKHVHQCLICARMNATTRTQLMGDLPEQRVNPSRPFINSGVDFAGPFHILMSRFRGCKTVKAYVCIFICMATKAIHIELVSDQTSEAFIGAFKRFVSRRGKCCHLWSDQGRNFIGADKELQDAWNEAQLQFPGNIAEKLAAEGTQWHFIPAYSPTFGGLWEAGVKSIKFHLKRILKTHLTFEEMSTILCQVEACLNSRPLCPLDDTDIENLNPLTPGHFLIGEAPIVVPSPNMKEVRVHHLSRWQHTQKLVNDFWRRWQDEYLSRLQQRPKWLRREEEFKIGDIVLIKTDYLPPGKWSLGRIVEKHPGPDNLTRVYSVKSGSAVTKRSITKLCCLPVDSNQ

Summary

Pfam
PF17921   Integrase_H2C2        + More
PF05585   DUF1758
PF03564   DUF1759
PF18701   DUF5641
PF00665   rve
PF05380   Peptidase_A17
PF00078   RVT_1
PF14529   Exo_endo_phos_2
Interpro
IPR008042   Retrotrans_Pao        + More
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR005312   DUF1759       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001995   Peptidase_A2_cat       
IPR000477   RT_dom       
IPR001878   Znf_CCHC       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
SUPFAM
SSF53098   SSF53098        + More
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
1620
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01462
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  1620
 
 

Population Genetic Test Statistics

Pi
506.037923
Theta
217.664298
Tajima's D
4.255513
CLR
0.350873
CSRT
0.999600019999
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号