SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15989
Annotation
PREDICTED:_ankyrin-3-like?_partial_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.09 Mitochondrial   Reliability : 1.197
 

Sequence

CDS
ATGGGTGGACGAGCTCACAGCCCACCTGGTATTAAGTGGTTACTGGAGCCCATAGACATCCACAACATAGATCCAAACACAGCATTTTTGCGAGCAGCACGTGCCGGTCAGCTCGACACAGTAATTGAGCTCCTCGATTCGGGCGCTGTCAAAGACATCAACACATGTAATACGAATGGACTGAATGCTCTTCATCTAGCAGCGAAAGATGGTCACATATCAGTGGTCGAGGAGCTGCTCAAACGGGGCGCCACCGTGGACGCTGCAACTAAAAAAGGCAACACAGCCCTACACATAGCATGTCTCGCGGGGCAGGAGGCGGTGGCGAAAGCCCTTCTCGGGGCCGGGGCGAAGGCCGACGCCCAATCCGCAGCAGGCTTCACACCTCTCTACATGGCTGCACAAGAGAATCATGCTGGATGCGTCAAGATGCTGCTTGCCGCTGGAGCCAGTCAAACTCTCGCTACAGAAGATGGTTTCACGCCATTAGCGGTGGCCATGCAGCAAGGACACGACAGGGTAGTCGCGGAACTACTGGAATCCGACACAAGGGGCAAGGTTCGATTGCCGGCGTTACACATCGCGGCCAAGAAAAATGACGTGAAAGCGGCAACTCTGCTGTTAGAGAACGAGCACAACCCGGACGCGTGCTCCAAGTCGGGGTTCACGCCGCTGCACATCGCGGCGCACTACGGGAACGCGGGCGTGGCGCGCGCGCTGCTGGCCGCCGGCGCGGACCCCGCGCGCGCCGCCAAGCACGCCATCACGCCGCTGCACGTGGCCAGCAAGTGGGGCCAGCTCGCCATGCTCGACCTGCTGCTCGAACACGGCGCGAATATAGCAGCAGTGACCCGCGACGGTCTGACCCCGCTACATTGCGCGGCGCGATCCGGACACAGCAATGTAGTGTCGCGGCTGCTGCAACACGGTGCGCCGATCACCAGCAAGACTAAGAATGGACTGACTCCTCTCCACATGTCCGTGCAAGGCGAACACGTGGAGACGGCCAAAGTACTCCTGACAGAGGGCGCGCCCATCGATGACGTCACAGTCGATTACCTCACCGCACTGCATGTCGCGGCTCATTGTGGACACGTCAAGGTGGCTAAACTGTTGTTAGATAGAAACGCGGATGCGAACGCACGAGCGCTGAACGGGTTCACGCCCCTCCACATCGCTTGCAAAAAGAACAGACTCAAAGTCGTCGAGTTGCTTCTTAAATATGGCGCCAGTAAATCGGCGACCACCGAGTCGGGCCTGACGCCTCTCCACGTGGCGTCGTTCATGGGCTGCATGAACATAGCGCTGGTGCTCATAGGGGCGGGCGCGGACGCCGACGCCGCCACGGCCCGCGGGGAGACGCCGCTGCACCTGGCCGCCAGGGCGCACCAGACCGACCTGGTCCGGGTGCTCCTCAGGAATAACGCTAAGGTGGACGCGCGCGCCCGCGAGGAGCAGAGCCCGCTGCACGTGGCGGCGCGGCTGGGGCACGCCGACATCGCGGCGCTGCTGCTGCAGCACGGCGCCGACGTGGCCGCCACCACCAAGGATCGGTACACGCCGCTGCACATCGCCGCCAAAGAAGGCAAAGAAGAAGTAGCGGCTATACTCCTGGACAACAACGCGCCCATAGAAGCGGAGACGCGCAAAGGGTTCACGCCGCTCCACCTGGCGGCCAAGTACGGAGACATCGGCGTGGCGCGGCTGCTGCTGGCCCGCGGGGCGCAGCCCGACGCGCCCGGCAAGAGCCACATCACCCCCCTGCACATGGCCACCTACTACGGACACCCCGACATCGCCTTGCTGCTGTTAGATAAAGGCGCATCTCCGCATTCGTTAGCCAAAAACGGTCACTCGGCTCTGCACATCGCCTGTCGGCACAACCACCCCGATATCGCCTTTGCACTTCTTGAACACGATGCCGATCCCGGGGTAAAATCGAAAGCCGGGTTCACACCTCTACACATGGCGGCACAAGAGGGACACGAGGACTGCGTCGAGATGCTCATCGAGAGAGGAGCTGACGTTAATGTACCTGCAAATAATGGTCTGACTCCGGTGCACCTGGCTGCGTCGGAGGGTCGCACGGGCGTGCTGAAGGCGCTGCTGGCGGCGGGCGGGCAGTGCTCCGCCAAGACGCGCGACGGGTACACGCCGCTGCACGCCGCCGCGCACCACGGTCACCACGCCGCCGCCAGGACGCTCATCGATGCCGACGCTGACGTCACAGCTAAAGCCGCGCACGGGTTCACGCCGCTGCACCAGGCCGCGCAACAAGGACACACGCTTATTATACAGCTGCTGTTGAAACACAACGCCGACCCCAACGCACTGTCAGCCAACGGTCAGACGCCGTGTGCCATCGCGGACCGGCTGGGTTACATCAGCGCGGTGGAGGCGCTGCGCCCCGTCACCGAGAACACGCTCAGTCAGGCCGTCGGGGACACCGGTAAGTGGCGTGCTTCAATAAGACTCCTACCTTGA
Protein
MGGRAHSPPGIKWLLEPIDIHNIDPNTAFLRAARAGQLDTVIELLDSGAVKDINTCNTNGLNALHLAAKDGHISVVEELLKRGATVDAATKKGNTALHIACLAGQEAVAKALLGAGAKADAQSAAGFTPLYMAAQENHAGCVKMLLAAGASQTLATEDGFTPLAVAMQQGHDRVVAELLESDTRGKVRLPALHIAAKKNDVKAATLLLENEHNPDACSKSGFTPLHIAAHYGNAGVARALLAAGADPARAAKHAITPLHVASKWGQLAMLDLLLEHGANIAAVTRDGLTPLHCAARSGHSNVVSRLLQHGAPITSKTKNGLTPLHMSVQGEHVETAKVLLTEGAPIDDVTVDYLTALHVAAHCGHVKVAKLLLDRNADANARALNGFTPLHIACKKNRLKVVELLLKYGASKSATTESGLTPLHVASFMGCMNIALVLIGAGADADAATARGETPLHLAARAHQTDLVRVLLRNNAKVDARAREEQSPLHVAARLGHADIAALLLQHGADVAATTKDRYTPLHIAAKEGKEEVAAILLDNNAPIEAETRKGFTPLHLAAKYGDIGVARLLLARGAQPDAPGKSHITPLHMATYYGHPDIALLLLDKGASPHSLAKNGHSALHIACRHNHPDIAFALLEHDADPGVKSKAGFTPLHMAAQEGHEDCVEMLIERGADVNVPANNGLTPVHLAASEGRTGVLKALLAAGGQCSAKTRDGYTPLHAAAHHGHHAAARTLIDADADVTAKAAHGFTPLHQAAQQGHTLIIQLLLKHNADPNALSANGQTPCAIADRLGYISAVEALRPVTENTLSQAVGDTGKWRASIRLLP

Summary

EMBL
RSAL01000012    RVE53499.1    KQ459460    KPJ00653.1    NWSH01000025    PCG80610.1    + More
AGBW02007724    OWR54663.1    KQ979403    KYN21720.1    KQ435775    KOX75027.1    GBYB01013630    JAG83397.1    KQ434817    KZC06871.1    KQ414747    KOC61883.1    KQ971328    KYB28369.1    KYB28368.1    KYB28367.1    GDUN01000063    JAN95856.1    GBYB01013640    JAG83407.1    JR035606    AEY56539.1    CH478035    EAT34273.1    GALX01005207    JAB63259.1    JR035603    AEY56537.1    JR035605    AEY56538.1    JR035602    AEY56536.1    GEBQ01011642    JAT28335.1    GEBQ01032238    JAT07739.1    GFDL01003846    JAV31199.1    GFDL01003844    JAV31201.1    GANO01003559    JAB56312.1    KQ971332    KYB28285.1    KYB28283.1    LBMM01000066    KMR05097.1    KYB28284.1    ATLV01023434    KE525343    KFB49171.1    KYB28281.1    GL771866    EFZ09225.1    NEVH01013198    PNF30054.1    AXCN02000654    APCN01001695    APCN01001696    UFQT01001345    SSX30122.1    AAAB01008980    SSX30119.1    JRES01000375    KNC31858.1    AAAB01008799    EGK96183.1    SSX30120.1    SSX30118.1    PNF30051.1    GGFL01003220    MBW67398.1    SSX30125.1    SSX30123.1    SSX30124.1    GEBQ01020910    JAT19067.1    SSX30121.1    KQ761592    OAD57374.1    EAA14062.4    GEBQ01016181    JAT23796.1    EGK96182.1    ADMH02001962    ETN60218.1    GEBQ01022757    JAT17220.1    GGFM01000644    MBW21395.1    AXCN02001215    GEBQ01028536    JAT11441.1    GEDC01029524    JAS07774.1    GECZ01011883    JAS57886.1    GEDC01031701    JAS05597.1    ADTU01003819    ADTU01003820    ADTU01003821    ADTU01003822    ADTU01003823    ADTU01003824    ADTU01003825    EAA03765.4    CH477775    EAT36335.1    UFQS01000711    UFQT01000711    SSX06344.1    SSX26698.1    KQ977220    KYN04819.1    KQ983114    KYQ47306.1    GL888331    EGI62644.1    KQ981768    KYN35967.1    GBBI01002507    JAC16205.1    APGK01026876    KB740648    ENN79711.1    GBRD01005882    JAG59939.1    GBRD01005877    JAG59944.1    GBHO01009555    JAG34049.1    GBHO01016755    JAG26849.1    GBHO01016753    JAG26851.1    GBRD01005875    JAG59946.1    GBHO01016751    JAG26853.1    GBRD01005883    JAG59938.1   
Pfam
PF00023   Ank        + More
PF13606   Ank_3
PF12796   Ank_2
PF00791   ZU5
PF17809   UPA_2
PF01442   Apolipoprotein
PF00531   Death
PF00651   BTB
PF00415   RCC1
Interpro
IPR040745   Ankyrin_UPA        + More
IPR000906   ZU5_dom       
IPR036770   Ankyrin_rpt-contain_sf       
IPR020683   Ankyrin_rpt-contain_dom       
IPR002110   Ankyrin_rpt       
IPR011029   DEATH-like_dom_sf       
IPR000074   ApoA_E       
IPR000488   Death_domain       
IPR009091   RCC1/BLIP-II       
IPR011333   SKP1/BTB/POZ_sf       
IPR000210   BTB/POZ_dom       
IPR000408   Reg_chr_condens       
SUPFAM
SSF48403   SSF48403        + More
SSF47986   SSF47986       
SSF54695   SSF54695       
SSF50985   SSF50985       
Gene 3D
PDB
4RLV     E-value=0,     Score=2043

Ontologies

Topology

Length:
827
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0509800000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00032
outside
1  -  827
 
 

Population Genetic Test Statistics

Pi
158.369711
Theta
150.832803
Tajima's D
0.215861
CLR
104.217548
CSRT
0.432528373581321
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号