SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15988
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 1.731
 

Sequence

CDS
ATGATGGCACATTGTAAAAAGTTTGTACCCCAGGAGGGTACCGCCCGCGAGTCGGGCGGAGAATCCCTCCGTGCTTCCACCTCAGTGGAAGCACGCTGCCCCACGTACTCTGGGGGGGGCAACAATTGTCAGGATGAAGGGGGCTGTGCGACGGGCAGCGGAATTCCCGTCGAACCGAGGTGTTCCCCGATCGCCGGCTCGATGCGCTCTGCGCTCGCCAGCGACTCGGGTATAATCAGTCCCACCAAACCATCGGCGGGGAAAAAGAGGGGGAGAAGAAAGACGGCATTACCAATTTCCGATGACAGCTGCGCGTCATCCTCCGGCACTGAGGTGCCGGAAAAGACGATGGCCATCGAGGAGGTGACTCCGGTGGTTCCGGGGCCTGCTACGTCGGAAGACGCGATGCCCGCTCCCCAGTGGGTACCAGTGAGGAGGAGGGGCGCTGTGTCACCAGCGACGTCCGTGGAGTCGATGTCGACGTCGGCCGCGTCCCTGGCTAGCGGGGACGAGACGTTCCGGGACCTCGACCTTGCACTGGTCAATTTGGGCAAGCTGCTGTCGACTGTGGCTGCCAAGGGCGCCGAGCCAGGCAGCAGCTACCGGAAACGGCTCCGGGAGGCAGCCGCTATGGTGAGAACAAGGCTGATCCCCACCATGTCCAAGCTTTATGACTTGGTAGAGAGCCGAGAGGTGGAGAGCAAAGATCTTGTCGCTCATTGTGACTCCAGAGAGAGTCGCATCTCGGGAGATACCCCGGCCTTGCGGGGAGGGACTCCCCTGTTGCCGAGGCCGCCGCTGGCTCGCTCTGGCCCCCCCGCGGGGGCGATGGATATTGACGTGCACTTGCGGTCCGCTGTGAGTGTGACGGCGCAAATGCCAGAGCCCAATCCTGTGGCCCCTGTCCCGCTAGCGCATAGCCCCGCGCTCCCTCGCCCTCCACGTAGGGTCGAGTTAAGGCCTGCGCCGCCTCCGCGGATATCGGCCGCCCCTGCGTCTACACGGAGAGGAAGGCTAAGCCCTGCGCCAGCGCGGGCTGAAGACATCCGTTCGCCACTGGCGAGGATGGTGGATGAGTGGCCGGCGCTACCGCCGCCTCTTTCGCCCTCGCGTGCTGCGGGGTTGCAGGCTCGCGGGCCACACAACACGGCTGCTGGGATGGTAGAGGTGGACTCCCTCCCAAGCAGAGAGGAAATGGTGGCCTGTATCTCGCGGGCGGTGGCGGTTGAGGTCGGCAAGCACTTTGCCGGCCTCGAGGAGATGCTCCGTTCCTCGATTGGTTCCGGAGACTGCATCCCGGCGCCAACAGCTGCAGCCACCCCGCGGAGCCAGGCCGCCCGGCCGACCTCTATCCCCACTCCATCCGCGAGGTTGGCACGGCGTAGAGGCCGGGACCAAAACAACAAGGGTACGGGTGCCCAGAATCCTGCCCCAAAATCCCAACCCCGTCCCCTTCCTGCTCCCCCGTCAAGCATGGACGAGGGCTGGACGGAAGTGGTGAAGCGGGGCAAGAAAGCAAGGCAGCAGACAGCGGCTCTGGCAGCTCCCAGAGGGGGTCGAGCGCCGATCGCTGCAGCACGAAGCACAGAGCTGGCGGCCGTAGCTGCTCCTCGTGAGAATCGAGCACTGGCAGCCAGGAAGAAGAATGGTAAAAAGAAGAGGCCGCGCGCAGTGCGGTCGGCTGCCGTCGTAGTGACGTTGCTGCCGGCCGCTGCCGAAAAGGGCCTCACCTATAATGAGGTGATGGCCCGGGCGCGCGCGGCCGTAAGTTTGGATGAAATCGGGGCAGAGGAGGGCCTCCGCTTCCGGCACACAGCCAATGGAGCGAAGCTGCTGGAGTGTCCCGGTGCCGATAGTTCTGGCATCGCGGACAAACTAGTGGCGACGCTCCGCGTGGCACTGCCGGAGGATGAGGTGCGCGTGCACAGGCCGGTGAGGATGGCCGAGATTAGAATCACCGGCCTGGACGACTGTGCTACCAAGGAGGAGGTGGCAGCCGCGATAGCCGCCCAAGGTGGATGTGCCCTGGAGAGCGTGACCGTGGGCGAACTTCGCTCAGGGTACTCTGGAGCCAGGTCGGTGTGGGCGCGCTGCCCTGTGGAGGCAGCCACTTCCTTGGCCACTCCTCCGCCGGGAAGATCGACGGGGGACCCGGGGAGACTGCGCGTGGGCTGGATAGCGGCCCACGTGCGTCTCCAAGAACCACGTGCCTGGCGATGTCTCCGATGTTTTAGCACCGGGCACGGCCTCGCTAGGTGCACTAGCTCGGTTGACCGCAGCGGTCTGTGTTTCCGCTGCGGCCAGCCGGGCCATAAAGCGGCGTCCTGCACAGCCGCCCCGCACTGCGCTCTGTGCGCTGCGGCCGGGCGCAGGGCAAACCACCGGGCGGGAGGCAAGGCGTGCTTCCCGTCCGGTGATAATACCGAACGCAACCGGCGCCGAAAATCAAAGCGCCGACAAAAGAGAAGGTTGGCCAGAGGAGCACTGGCCAACGCTGTAATCCCCGATGCGGCGCCGGTGCCGGAGGGCGGGGGCAGCGGTGAAGGGGAGGGGGCGATGGATGTGGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGATATGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCAGCAAATGATTGCTGGTTTGGGGACGACGGCGGCCTGGCGGCCATAGTCATAAGAAGAGACGCGGCGATCCCCCTCCTGGCGATGGTGACCAGGGGTCAAGGGTTCGTCGCGGTGCAGCTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAATAGGCCTACCGTCGAGTTCGGGCATTTCCTGGGCGGGATCGGGGCGATTGCTCGCCGCCTCGCTCCTCGTCCAGTGATTCTCGCGGGGGACCTCAATGCGAAGTCTGTCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTACTGGAGAGGTGGGCGCACGCGGCCGGCCTCTGTTTGTTGAATAGAGGTTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCAAGCCCGGCCATCGCACGCCGTATCCGCGACTGGAGAGTTTTGGAGGGGGCGGAGACGCTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGTCCACGGGGACCACCCCCGTGGTGCATCCCGGTCATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGCGCTCCTGATGGAAGCCTCTACGGTGGCGGCGTGGGCGCCCATGCGTCCACACCCAGTCGAGGTCGAGGGAGAGGCGGGGTGGTTCCGGGACACGATGCGTCGCATCTGTGATGCGTCGATGCCCCGGATCGGCCCTAGACTCCCTAATCGCCAGGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCGCCTGCCGCGGCGCAACGATCCGGTTGCGTTCGCGGCGGCAGAGGCCCGGCTGCACGGCGCATTTCGCGTCGCGCAGAGGGCATTGCAGCTGGCCATCAGAAGAGCCAAGAACCAACACATGGAGGGTCTCTTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCGGGAGGGATTTTCCGCTCCCGCTATGGACGCGCCGCCGGAATACGACGGCGAAGTCCCTGCTGAGGTGCCCCGCATAACGGGGGCGGAGCTCCGTGTGGCCGTGCGCAAAATGTGCGCGAAAGACACTGCACCCGGCCCGGACGGCGTGCATGGCCGGGTTTGGGCCTTGGCTCTTGATGCCCTAGGGGACCGACTCTTGAGGCTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTGGTCAGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCTCTCGACATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGGCACGGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGATCGTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGACGACACGTTGGTCGTGGCCCGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACCGCTGGGGTGGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCACTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGGATTGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCATTTTCAGCACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCTGTGTGGGGCCAGTCCCTGGCCGCGGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGCTCTGGAAGCGGAGGCGCTCGCTGCTGACTATCAGTGGCGGGCTGACCTTCGCGCCCGGGGCGTGGCGCGTCCCAGCCACAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGGCGGCTGGCTGAACCTTCGGCCGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCAGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGATTGCGACTTGGACACGGCAGAGCATACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAGTAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAATCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MMAHCKKFVPQEGTARESGGESLRASTSVEARCPTYSGGGNNCQDEGGCATGSGIPVEPRCSPIAGSMRSALASDSGIISPTKPSAGKKRGRRKTALPISDDSCASSSGTEVPEKTMAIEEVTPVVPGPATSEDAMPAPQWVPVRRRGAVSPATSVESMSTSAASLASGDETFRDLDLALVNLGKLLSTVAAKGAEPGSSYRKRLREAAAMVRTRLIPTMSKLYDLVESREVESKDLVAHCDSRESRISGDTPALRGGTPLLPRPPLARSGPPAGAMDIDVHLRSAVSVTAQMPEPNPVAPVPLAHSPALPRPPRRVELRPAPPPRISAAPASTRRGRLSPAPARAEDIRSPLARMVDEWPALPPPLSPSRAAGLQARGPHNTAAGMVEVDSLPSREEMVACISRAVAVEVGKHFAGLEEMLRSSIGSGDCIPAPTAAATPRSQAARPTSIPTPSARLARRRGRDQNNKGTGAQNPAPKSQPRPLPAPPSSMDEGWTEVVKRGKKARQQTAALAAPRGGRAPIAAARSTELAAVAAPRENRALAARKKNGKKKRPRAVRSAAVVVTLLPAAAEKGLTYNEVMARARAAVSLDEIGAEEGLRFRHTANGAKLLECPGADSSGIADKLVATLRVALPEDEVRVHRPVRMAEIRITGLDDCATKEEVAAAIAAQGGCALESVTVGELRSGYSGARSVWARCPVEAATSLATPPPGRSTGDPGRLRVGWIAAHVRLQEPRAWRCLRCFSTGHGLARCTSSVDRSGLCFRCGQPGHKAASCTAAPHCALCAAAGRRANHRAGGKACFPSGDNTERNRRRKSKRRQKRRLARGALANAVIPDAAPVPEGGGSGEGEGAMDVDMLSQSMAEWSIDMAVVAEPYFVPPANDCWFGDDGGLAAIVIRRDAAIPLLAMVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLGGIGAIARRLAPRPVILAGDLNAKSVAWGSPRSDARGRLLERWAHAAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADVHGDHPRGASRSFPKWALKRLNKALLMEASTVAAWAPMRPHPVEVEGEAGWFRDTMRRICDASMPRIGPRLPNRQAYWWSPEIAQLRVECVRARRECARHRRRRLPRRNDPVAFAAAEARLHGAFRVAQRALQLAIRRAKNQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQEREGFSAPAMDAPPEYDGEVPAEVPRITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALDALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVRVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIGGALERHGVPPYLRRLVGSYLEDRSVTCTGHGGIVHRFPVVRGVPQGRHVGRGPGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQHLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAAGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWALEAEALAADYQWRADLRARGVARPSHSVVRARRAQSRRSVLESWSRRLAEPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIRAEPTAECHHCDCDLDTAEHTLVACPAWEGWRRVLVAKVGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQSRRRRAGAREADLAQALAL

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF57756   SSF57756        + More
SSF56219   SSF56219       
Gene 3D
ProteinModelPortal
PDB
1WDU     E-value=9.77362e-11,     Score=167

Ontologies

Topology

Length:
1865
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.08459
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00012
outside
1  -  1865
 
 

Population Genetic Test Statistics

Pi
125.656193
Theta
126.345544
Tajima's D
0.045548
CLR
118.569907
CSRT
0.386780660966952
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号