SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15957
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon X-element       + More
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.565
 

Sequence

CDS
ATGGCGTGCAACGGTAGGGAAAAACCGCGTTCCATAAAGTTAGCATTTTATAATGCTAACGGACTCGCGCGTCAGCGCGATCAAGTATATGAGTTTCTCCGCGATAATCTCATCGACATCCTTCTGGTGCAGGAGACCTTCCTAAAGCCCTCGCGTCGCGACCCCAAAGTCGCGAATTACGTCATAGTTAGGAATGACAGACTCTCCGCCCGCAAGGGCGGGACTGTCATTTACTATAGGAGGGCCCTGCACTGCGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGCATCGCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCTGACAAACCCCTCCTGAGCAGTGACCTCGAGACACTGTTCGGTATGGGGGACGCGGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGTATTCAACCCCCGACCCCCACGTGCTATCCGTACAACGCCGCGCGTCGTCCGAGCACAATAGATCTGGCACTGCTGAGGAACGTAACTCTGCGCTTGCGCTCCATCGAGGCAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGATACCGTCGAATCCATAAACATCTTCACTGATCACGTCTCGACGGCGATCATAAGATCTTCGAAACAAGTCGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGATCTTAGGGACCTCGTTAGAATCAGAAACGCGGCAATCCGGGCCTACGATCGATATCCCACGGATTCAAACCGGACTCGGATGCGTCGCTTACAGCGGGAGGTCAAATCCCGCTTAAGCGACGCCCGAAACGAAAACTGGGATAGTTATTTAGAAGAACTCGCGCCCACTCACCAAGCATACTGGCAACTAGCTAGGACCCTCAAGTCCGAAACTATAGCCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAATCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTCGTCGACAGGGAGGAGGCGATCGATAGCCTACAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAACTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATATTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTTTACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAATAAAATTCTTATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGGCTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGTATATTAACGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATTAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCTCTCCCGACTAGGCGCGTCAACACCCCCGCCCCCGCCGTTCGCCCAATCACGATGTACGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATCAAGACGGTACGCGATCGTGCCGCCTTCATCCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCAGCCCGCATACACTTAAAATCCTTTCAAATCATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTTCAGTCGGCGTCCATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTCCCGATCCACTAACGGTGCTTTTAGTTTGCGGGGTCAGTAAATAA
Protein
MACNGREKPRSIKLAFYNANGLARQRDQVYEFLRDNLIDILLVQETFLKPSRRDPKVANYVIVRNDRLSARKGGTVIYYRRALHCVPLDTPSLLHIEASVCRIALTGHQPIVIASVYLPPDKPLLSSDLETLFGMGDAVILAGDLNCHHTSIQPPTPTCYPYNAARRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESINIFTDHVSTAIIRSSKQVDVEDCFHRIRLSPDLRDLVRIRNAAIRAYDRYPTDSNRTRMRRLQREVKSRLSDARNENWDSYLEELAPTHQAYWQLARTLKSETIATMPPLVRPSGQSPAYDDDDKAELLADALQEQCTTSTQHADPEHTEFVDREEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNTPAPAVRPITMYDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARIHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLVCGVSK

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon X-element
EC Number
2.7.7.49
EMBL
AB018558    BAA76304.1    U07847    AAA17752.1    AB055391    BAB21761.1    + More
AF081103    AAC72921.1    KQ459265    KPJ02064.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    KQ971729    KYB24751.1    GALX01005299    JAB63167.1    GALX01005359    JAB63107.1    GBBI01004395    JAC14317.1    GBBI01004571    JAC14141.1    GGMR01018716    MBY31335.1    S59870    AAB26437.2    RPOV01000134    RPJ78669.1    ABLF02042518    ABLF02057746    GGMS01006359    MBY75562.1    NEVH01006736    PNF36716.1    GFTR01008038    JAW08388.1    GGFJ01001858    MBW50999.1    GGFJ01001857    MBW50998.1    KK119692    KFM76444.1    GGFJ01001844    MBW50985.1    GGMS01002992    MBY72195.1    GGFJ01001842    MBW50983.1    NEVH01011985    PNF31054.1    GGFJ01001843    MBW50984.1    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    GGFL01005012    MBW69190.1    GGFL01004957    MBW69135.1    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02008153    ABLF02008462    ABLF02008464    GGMR01003407    MBY16026.1    NEVH01021205    PNF19912.1    NEVH01017470    PNF24199.1    NEVH01016302    PNF25823.1    ABLF02034467    GGFJ01001822    MBW50963.1    GFTR01008271    JAW08155.1    ABLF02023911    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GEZM01053022    JAV74219.1    M95171    AAA29354.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    NEVH01026386    PNF14434.1    GFTR01008269    JAW08157.1    GFXV01000908    MBW12713.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GFTR01008261    JAW08165.1    NEVH01020940    PNF20481.1    JRES01000644    KNC29657.1    GEDC01000337    JAS36961.1    AY180919    AAN87272.1    GBGD01000415    JAC88474.1    GGMR01016296    MBY28915.1    GFTR01008279    JAW08147.1    GGMS01000737    MBY69940.1    GGMR01000676    MBY13295.1    GFTR01008262    JAW08164.1    ABLF02024246    GGFJ01002256    MBW51397.1    GGFJ01002257    MBW51398.1    GGMS01017365    MBY86568.1    GBGD01000389    JAC88500.1    NWSH01007753    PCG62823.1    GGMR01012305    MBY24924.1    GFTR01008151    JAW08275.1    AF237761    AAF81411.1    GFTR01008251    JAW08175.1    NEVH01005277    PNF39135.1    X17551    CAA35587.1    AY508487    AAS13459.1    GGMR01006408    MBY19027.1    NEVH01006721    PNF37225.1    AY060438    AAL25477.1    NEVH01019963    PNF22185.1    ABLF02040174    ABLF02040183    ABLF02055266    KU543673    AMS38352.1    GFTR01008257    JAW08169.1    GEZM01084969    JAV60363.1    DNOY01000259    HBE18313.1    GFTR01008260    JAW08166.1    GEHC01000968    JAV46677.1    GGFL01005121    MBW69299.1    AY047531    AAK77263.1    GGMR01016905    MBY29524.1    GFXV01002840    MBW14645.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.00124215,     Score=103

Ontologies

Topology

Length:
899
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.479480000000001
Exp number, first 60 AAs:
0.00034
Total prob of N-in:
0.00544
outside
1  -  899
 
 

Population Genetic Test Statistics

Pi
10.444574
Theta
14.766785
Tajima's D
0
CLR
1.151448
CSRT
0.378931053447328
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号