SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15951  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA013427
Annotation
PREDICTED:_uncharacterized_protein_LOC106123133_isoform_X5_[Papilio_xuthus]
Location in the cell
Cytoplasmic   Reliability : 1.747 Nuclear   Reliability : 1.074
 

Sequence

CDS
ATGACGACGGAGAACGCGACGCCTGGCCAGGCGGACGCCAGCACGGCGTTCCTACGCGCTGCCCGTGCCGGAAACATCGAGAAGATCATCAGTCTTCTCGAGCAAGGCGTTGATATCAACGTCAGCAATGCGAATGGCCTAAATGCCATCCATCTCGCTTCCAAAGACGGCCATGTCGAAGTAGTGAGGGTCCTGCTGGAGCGAGGAGCAGCAATCGACGCGGCCACCAAGAAAGGGAACACAGCACTTCATATTGCTTCTCTGGCTGGTCAAGAGGCAGTCGTTAAACTACTCGTCCAAAATGGAGCTCAGGTCAACATCCAATCCCAGAATGGTTTCACACCTTTATACATGGCAGCCCAAGAGAACCACGACGGTGTGGTCAAGTTTCTTCTTGGTAACGGTGCGAACCAGAGCCTTGCCACTGAGGACGGATTCACGCCTCTAGCGGTGGCGATGCAACAAGGACACGAGAAAGTAGTGGCAGTTCTTTTAGAGGCAGACACGCGCGGTCGAGTGCGACTACCAGCCCTTCACATTGCAGCCAAGAAAGACGACGTGAAGGCTGCTAACTTACTCTTAGAGAACGAGCACAATCCAGACGTGACCTCTAAGTCTGGATTCACTCCGCTACACATCGCGGCTCACTACGGCAACGAAGCAGTCGCAAGACTATTGCTGGCCAAAGGCGCTGACGTCAACTGTGCTGCGAAACACAACATATGTCCGTTACACGTCGCTGCCAAATGGGGCAAGGAGAATATGGTAGCTTTGTTATGCGATAATGGGGCGAATGTAGAGGCCCGCACTAGAGATGGGCTGACCCCTCTACACTGTGCCGCCAGATCTGGCCACGAGAGAGTCGTTGAAGCTTTACTTGATAGGGGTGCTCCTATTACCAGTAAGAGCAAGAACGGTCTAGCCCCGTTGCACATGTCGGCGCAAGGCGAACACGCCGAGGCGGCGCGCGTGCTCTTGTCGCGACGCGCCCCCGTCGATGACGTCACCGTGGACTACCTCACCGCGCTTCATGTAGCCGCTCACTGCGGTCACGCTAAAGTCGCGAAACTGCTTTTAGATAGAAATGCCGACGCGAACGCTAGAGCCTTGAATGGCTTCACACCTTTGCACATCGCCTGCAAGAAAAATAGGATCAAGGTCGTTGAGTTACTCCTCAAATACGGTGCAAGTATCCAGGCAACAACAGAATCAGGTCTTACGCCCCTCCACGTGGCGGCTTTTATGGGCTGCATGAACATCGTGATTTACTTACTCCAGCACGAGGCGAATCCTGATGTTCCCACGGTCAGGGGAGAGACACCGCTACATTTGGCAGCAAGAGCTAACCAGACTGACATTATCCGTATTCTTCTACGTAACGGCGCGGCCGTCGAAGCCAAGGCTCGTGAGAGGCAAACCCCTCTCCACATCGCGTCTCGGCTCGGTAACGTCGACATCGCAGTACTGCTGTTACAGCACGGCGCTGACGTCAGAGCCATTACTGCTGACCATTACAATCCACTGCACATCGCTGCCAAACAGCACAATCACGATGTTGCAGCAGCTTTAATTGAACACAACGCACCCCTAACTGCGACCACAAAGAAAGGGTTCACCGCTCTTCATCTGGCTGCGAAGTATGGGAACCTGAAGGTTGCGAATCTTTTACTCGCTCACGGTGCGGCTCCAGACCAAGCTGGTAAAAATGGCATGACTCCTCTACACATCGCTGCACAGTACGACCAGCAAGCCGTCGCCACTACGCTCCTTGAGAAAGGAGCTGATGCTAAGGCTGTAGCCAAGAACGGGCATACACCTCTTCATATCGCGGCTCGTAAGAATCAAATGGAAACTGCAGCCACGCTTCTCGAGTACGGAGCGTTGACCAACGCTGAATCAAAGGCTGGATTTACTCCTCTGCATTTGGCTGCCCAGCAGGGTCACACCGAAATGTGCGCTCTGCTTCTCGAACATAGCGCTGAACCAGAGCATCAGTCTAAAAACGGGCTGGCAGCATTGCATTTGGCTGCTCAAGAAGATAAGGTCCCAGTAGCACAACTGCTAGTGAAGCATGGCGCTGAGGTGGACATCTGCACTAAGGGCGGCTACACGCCTCTACACATTGCCAGTCACTATGGCCAACCGAACATGGTGCGCTATTTACTCGAAAATGGTGCTTCTGTTAAAGCTCAAACCGCACATGGTTACACAGCCCTACATCACGCCGCTCAGCAGGGCCACATTAATATTGTGAATATTCTACTTGAACACAAAGCAGATGCAAACGCGACGACTACGAGCGGACAAACTCCTTTGGATATAGCGTCCAAGCTGGGTTACGTAACAGTGATGGAGACTCTTAAGGAAATATCAGAGCCGTCGTCGGCACCAGCCTCGCAGGAAAAGTACAAGGTGGTCGCCCCGGAGACCATGCTTGAGACCTTCATGTCTGACTCAGAGGAAGAAGGTGGTGAAGACACCATTCTAAACGACCAGCCATACAGATATCTGACCGCCGATGATATGAAGTCTTTGGGAGATGATTCTCTGCCAATCGACGTGACTAAGGATGAACGAACAGAATCCGCCATGAGCCATAAGAATATCATGGAAATCTCTCAAGGGTCTATGAACGGGATTCCGTACCAACCTCAGCAAGAAGTGGTGGTGAAGAGCATTAGTCGTTACAGTACTGCACAGGCTCCTGAGGCGTATTGCTACAACTGA
Protein
MTTENATPGQADASTAFLRAARAGNIEKIISLLEQGVDINVSNANGLNAIHLASKDGHVEVVRVLLERGAAIDAATKKGNTALHIASLAGQEAVVKLLVQNGAQVNIQSQNGFTPLYMAAQENHDGVVKFLLGNGANQSLATEDGFTPLAVAMQQGHEKVVAVLLEADTRGRVRLPALHIAAKKDDVKAANLLLENEHNPDVTSKSGFTPLHIAAHYGNEAVARLLLAKGADVNCAAKHNICPLHVAAKWGKENMVALLCDNGANVEARTRDGLTPLHCAARSGHERVVEALLDRGAPITSKSKNGLAPLHMSAQGEHAEAARVLLSRRAPVDDVTVDYLTALHVAAHCGHAKVAKLLLDRNADANARALNGFTPLHIACKKNRIKVVELLLKYGASIQATTESGLTPLHVAAFMGCMNIVIYLLQHEANPDVPTVRGETPLHLAARANQTDIIRILLRNGAAVEAKARERQTPLHIASRLGNVDIAVLLLQHGADVRAITADHYNPLHIAAKQHNHDVAAALIEHNAPLTATTKKGFTALHLAAKYGNLKVANLLLAHGAAPDQAGKNGMTPLHIAAQYDQQAVATTLLEKGADAKAVAKNGHTPLHIAARKNQMETAATLLEYGALTNAESKAGFTPLHLAAQQGHTEMCALLLEHSAEPEHQSKNGLAALHLAAQEDKVPVAQLLVKHGAEVDICTKGGYTPLHIASHYGQPNMVRYLLENGASVKAQTAHGYTALHHAAQQGHINIVNILLEHKADANATTTSGQTPLDIASKLGYVTVMETLKEISEPSSAPASQEKYKVVAPETMLETFMSDSEEEGGEDTILNDQPYRYLTADDMKSLGDDSLPIDVTKDERTESAMSHKNIMEISQGSMNGIPYQPQQEVVVKSISRYSTAQAPEAYCYN

Summary

EMBL
BABH01026485    BABH01026486    BABH01026487    RSAL01000012    RVE53517.1    NWSH01000003    + More
PCG81036.1    ODYU01006276    SOQ47970.1    KQ459590    KPI97463.1    CH477775    EAT36335.1    CM000159    KRK01379.1    NEVH01013198    PNF30054.1    KRK01369.1    KRK01376.1    AE014296    AAF50525.4    ABW08487.1    ADV37501.1    CH902618    KPU78721.1    EDV40733.2    KPU78732.1    ADV37505.1    KRK01370.1    KRK01373.1    KRK01371.1    EDW93791.2    KPU78726.1    ABW08486.1    ADV37506.1    AHN57995.1    KRK01372.1    KRK01377.1    KRK01374.1    KPU78725.1    AAN12046.2    PNF30051.1    CH954178    KQS43297.1    AAAB01008799    EGK96183.1    KPU78724.1    KPU78734.1    AHN57996.1    AGB94230.1    EGK96182.1    CM002912    KMY98183.1    KMY98195.1    KMY98192.1    GECZ01011883    JAS57886.1    AXCN02001215    KRK01375.1    KMY98175.1    CH933809    KRG06006.1    KQ977220    KYN04819.1    KMY98187.1    ABW08485.1    KMY98194.1    KMY98178.1    KRG06005.1    CCAG010020781    CH379069    KRT07608.1    KQ983114    KYQ47306.1    KPU78729.1    KPU78727.1    KPU78722.1    ADV37504.1    KRK01368.1    GDHF01033775    GDHF01029616    GDHF01012932    JAI18539.1    JAI22698.1    JAI39382.1    AF190635    BT133155    AAF73309.1    ABW08483.1    AEZ02848.1    KPU78730.1    EAA03765.4    ABW08488.1    GECU01029664    JAS78042.1    KMY98181.1    KMY98177.1    GECU01033946    JAS73760.1    UFQS01000711    UFQT01000711    SSX06344.1    SSX26698.1    GBXI01003801    JAD10491.1    KMY98191.1    GDHF01030234    GDHF01000529    JAI22080.1    JAI51785.1    KMY98190.1    KQ971332    KYB28281.1    CH916366    EDV97423.1   
Pfam
PF17809   UPA_2        + More
PF00791   ZU5
PF12796   Ank_2
PF00531   Death
PF00023   Ank
PF13606   Ank_3
PF01442   Apolipoprotein
Interpro
IPR002110   Ankyrin_rpt        + More
IPR000488   Death_domain       
IPR040745   Ankyrin_UPA       
IPR020683   Ankyrin_rpt-contain_dom       
IPR000906   ZU5_dom       
IPR011029   DEATH-like_dom_sf       
IPR036770   Ankyrin_rpt-contain_sf       
IPR000074   ApoA_E       
SUPFAM
SSF47986   SSF47986        + More
SSF48403   SSF48403       
Gene 3D
PDB
4RLV     E-value=0,     Score=2458

Ontologies

Topology

Length:
908
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01839
Exp number, first 60 AAs:
0.0001
Total prob of N-in:
0.00077
outside
1  -  908
 
 

Population Genetic Test Statistics

Pi
288.902645
Theta
173.506502
Tajima's D
2.063803
CLR
0.365661
CSRT
0.891805409729513
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号