SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15925
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.69 Nuclear   Reliability : 2.239
 

Sequence

CDS
ATGCCGCCTCTCGTACGCCCCTCAGGCCAATCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTCGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTCAAGGAGGCGATCGATAGCCTACAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAACTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATACTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAACAAAATTCTGATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGGCTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCCCTCCCGACTAGGCGCGTCAACACCCCCGCCCCCGCCGTTCGCCCAATCACGATGTTCGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATACTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATTAAGACGGTACGCGACCGTGCCGCCTTCATTCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCATACACCTAAAAACATTTCAAATTATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTTCAGTCGGCGTCCATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTCCCGATCCACTAACGGTGCTTTTAGGTACTTCAAGCACCGGTCACCGTTCTCGTCGAACCCGTCGCTTGCGACGAAGGGCTCGACGAGTAAATTAA
Protein
MPPLVRPSGQSPAYDDDDKAELLADALQEQCTTSTQHADPEHTEFVDREVERRASLPPSDALPPITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNTPAPAVRPITMFDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARIHLKTFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLGTSSTGHRSRRTRRLRRRARRVN

Summary

EMBL
AB018558    BAA76304.1    U07847    AAA17752.1    AB055391    BAB21761.1    + More
KC165845    AFY12622.1    KQ459265    KPJ02064.1    KQ459259    KPJ02068.1    AF081103    AAC72921.1    AF081101    AAC72919.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    GALX01005359    JAB63107.1    KQ973342    KXZ75569.1    GGMR01019198    MBY31817.1    GALX01005299    JAB63167.1    ABLF02014862    ABLF02014866    ABLF02061908    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02003961    ABLF02059872    KK117880    KFM71667.1    ABLF02042518    ABLF02057746    ABLF02008933    GFTR01008038    JAW08388.1    GGMS01000737    MBY69940.1    ABLF02033757    GGMR01016114    MBY28733.1    GGMS01004685    MBY73888.1    GEZM01038405    JAV81653.1    GGMS01008766    MBY77969.1    JXUM01155316    KQ572171    KXJ68070.1    GGMR01018716    MBY31335.1    GBBI01004571    JAC14141.1    GBBI01004395    JAC14317.1    GGMR01003407    MBY16026.1    RPOV01000134    RPJ78669.1    NEVH01007393    PNF35987.1    NEVH01012089    PNF30491.1    NEVH01007578    PNF35646.1    NEVH01006736    PNF36716.1    GGMS01002992    MBY72195.1    GBBI01001646    JAC17066.1    NEVH01006721    PNF37225.1    GGMS01006359    MBY75562.1    GFXV01007093    MBW18898.1    GEZM01053022    JAV74219.1    GGMS01012005    MBY81208.1    GGMR01000676    MBY13295.1    S59870    AAB26437.2    NEVH01026386    PNF14434.1    NWSH01000032    PCG80497.1    LBMM01010106    KMQ87671.1    NEVH01010546    PNF32261.1    GGFJ01002256    MBW51397.1    GFXV01006424    MBW18229.1    NEVH01003017    PNF40781.1    NEVH01023962    PNF17612.1    NEVH01005938    PNF38077.1    NEVH01020071    PNF21969.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01007443    PNF35684.1    NEVH01018383    PNF23463.1    GGFJ01002257    MBW51398.1    AF012049    AAC24972.1    NEVH01001355    PNF42855.1    NEVH01002704    PNF41489.1    NEVH01020940    PNF20481.1    ABLF02024246    NEVH01000269    PNF43694.1    NEVH01000280    PNF43672.1    NEVH01023961    PNF17613.1    GGFJ01001842    MBW50983.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GGFJ01001843    MBW50984.1    NEVH01019964    PNF22161.1    GGFJ01001844    MBW50985.1    GGMS01004444    MBY73647.1    JXUM01014072    KQ560393    KXJ82651.1    ABLF02020655    ABLF02039168    ABLF02061060    GGFJ01001858    MBW50999.1    NEVH01007838    PNF34986.1    JRES01000644    KNC29657.1    KK113014    KFM59099.1    NEVH01006754    PNF36554.1    NEVH01017542    PNF24034.1    NEVH01016302    PNF25823.1    LBMM01014395    KMQ85192.1    NEVH01014858    PNF27387.1    NEVH01002716    PNF41415.1    GGFJ01001857    MBW50998.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    GGMR01006408    MBY19027.1    PCG80496.1    NEVH01017559    PNF23833.1    NEVH01011985    PNF31054.1    PYGN01000192    PSN51582.1    GFXV01000774    MBW12579.1    GGMR01012305    MBY24924.1    NEVH01022639    PNF18527.1    GEZM01097906    JAV54051.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF10551   MULE
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.000934275,     Score=102

Ontologies

Topology

Length:
581
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.16734
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01805
outside
1  -  581
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
6.771148
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号