SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15924
Annotation
gag-like_protein_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.429 Nuclear   Reliability : 1.765
 

Sequence

CDS
ATGGAGTTCGAGTCGGCCGCCAGCCCGGAACCCGGACCCTCGGATGAGTTCAAAACCGTCACGCGCGGCAAAAAACGCGCCCGTGCCGTGGAACCGTCCACGGCGCCAAAACAGCCCAAGGCCGCGAACGCGTCGCGTCCTAAAGTCGTGGTCACACCCGACTCCCCTCGCCGCGCAACTCCGTCGCCGAAACCCGCGCCCGTCAACAAAATCGTCGCGCCCCCGCCCGTAATCCTACGTGAAAAATCCGCGTGGAACCGGGTATCCCAGGCCCTTACGGCCAACAAAATCAACTACTCCCAAGCGCGTAATCTCGCGCACGGGATTCAAATAAAGGTCGCAACGCCGGGCGACCATAGGGCCCTCACTTCTTACCTCCGAAAGGAGAGCATAGGATACCACACCTATGCACTCCAGGAGGACCGCGAGCTCCGCGTAGTAATACGCGGAGTACCAAAAGAGCTCGACGTCGAGCTAATCAAGGAAGACCTAATCAGGCAAACGTACCCAATCATAAGTGTGCACCGTATGCACAGCGGGCGCGATAAATTCGCGTATAACATGGTTCTCGTCGCGTTGGAACCAACCGCCGAAGGCAAACGAATTGCCTCAAGCCTCCGCACCGTTTGCGGGTTATCAGGGGTCACCGTCGAGGCCCCACACAAAAAAGGCACTCCCGGTCAGTGCCATAGGTGCCAACTGTATGGCCACTCCGCGCGCAACTGCCACGCGCGTCCGCGGTGCGTAAAGTGCCTCGGTGACCACGCGACAGCCGACTGTTCGCGGGTCAAAGAGACCGCGACCGAACCGCCGAGCTGTGTGCTCTGCCAGAAGCAGGGCCACACAGCCAACTACCGCGGATGGCCCAAGGCCCCGCGGAAGCGTCTGGCCAACGCGCCATCTAAAACCGTCGGCCCAAAGACTTCGGCGCCCCGCGCGCCGAAACCTGCCTTCGTGCCGGCACCGGTGCCCACCGTCTCCGCGTGGGCAAAACCGCTGCCGCTCACGTTGGCAGGGAAACCACCGGCACCCCAGCCCCTGCTCGCGCCGCGCCCCGCCCTCGCGCCCGGTCCCGCGCCTCGCCCCGGCCCCGCGCGGCCTGCCGTAAACGACTTTTCAATCGTGCGTGATTATATCGCCGCGATAAATATAGATCGCATGCGCTCGTTCGCCGACGCCATGCGCAGGGCAGTCACGGCCGATGACCGCCTATACGCGACGTTCGACCATATGGACGTCATCGAGTCCGTCCAGCGTACGCTGGCTTGA
Protein
MEFESAASPEPGPSDEFKTVTRGKKRARAVEPSTAPKQPKAANASRPKVVVTPDSPRRATPSPKPAPVNKIVAPPPVILREKSAWNRVSQALTANKINYSQARNLAHGIQIKVATPGDHRALTSYLRKESIGYHTYALQEDRELRVVIRGVPKELDVELIKEDLIRQTYPIISVHRMHSGRDKFAYNMVLVALEPTAEGKRIASSLRTVCGLSGVTVEAPHKKGTPGQCHRCQLYGHSARNCHARPRCVKCLGDHATADCSRVKETATEPPSCVLCQKQGHTANYRGWPKAPRKRLANAPSKTVGPKTSAPRAPKPAFVPAPVPTVSAWAKPLPLTLAGKPPAPQPLLAPRPALAPGPAPRPGPARPAVNDFSIVRDYIAAINIDRMRSFADAMRRAVTADDRLYATFDHMDVIESVQRTLA

Summary

Pfam
PF07530   PRE_C2HC        + More
PF14529   Exo_endo_phos_2
Interpro
IPR006579   Pre_C2HC_dom        + More
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
SUPFAM
SSF57756   SSF57756        + More
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
422
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00013
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00154
outside
1  -  422
 
 

Population Genetic Test Statistics

Pi
13.176085
Theta
16.77461
Tajima's D
-1.023842
CLR
22.897864
CSRT
0.129643517824109
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号