SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15919
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.705 Nuclear   Reliability : 1.495
 

Sequence

CDS
ATGAACATGGACAAAACAAAAATCACGTACAATGTCCATGTTGCACCCACCATAGTTACTATTGGGAGCTCTACTCTTGAAGTTGTTGACGAATATATATACCTAGGACAGGCAGTCCGATTATGTAGGTCCAACTTTGAGAGAGAGGTCAGTAGACGGATCCAACTCGGCTGGGCAGCGTTCGGTAAACTGCACAACGTCTTCTCGTCCAAAATACCTCAGTGCCTTAAGACAAAGGCGTACAACCGATGTGTGTTACCAGTGATGACTTACGGCTCGGAGACGTGGTGCTTCACTAGGGATCTTTTTAGAAGGCTCAAAGTCGCGCAGCGAGCTATGGAGAGGGCTATGCTCGGCATTTCTCTACGTGATCGAATTCGAAATGAGGAGATCCGTAGAAGAACGAAGGTTGCTGACATAGCCCGTATAATTAGTGAACTGAAGTGGCAATGGGCCGGCCACATAGCACGAAGAGAGGACGGTCAATGGGGCAGAAAGATCCTGGAGTGGCGACCACGTACTGGCAAGCGCAGTGTGGGACGGCCACCTACTAGATGGACCGACGACCTAGTAAAAAGCGCTGGGTCTCGTTGGATGCAGGTGGCAATGGACCGGTCACACTGGAAATCTATTGGAAAGGCCTATGTTCAGCAGTGGACGGCGATAGGCTGA
Protein
MNMDKTKITYNVHVAPTIVTIGSSTLEVVDEYIYLGQAVRLCRSNFEREVSRRIQLGWAAFGKLHNVFSSKIPQCLKTKAYNRCVLPVMTYGSETWCFTRDLFRRLKVAQRAMERAMLGISLRDRIRNEEIRRRTKVADIARIISELKWQWAGHIARREDGQWGRKILEWRPRTGKRSVGRPPTRWTDDLVKSAGSRWMQVAMDRSHWKSIGKAYVQQWTAIG

Summary

EMBL
FJ265543    ADI61811.1    FJ265544    ADI61812.1    EF113399    EF113400    + More
ABO45233.1    RSAL01002362    RVE40503.1    EF113398    EF113401    ABO45231.1    EF113402    ABO45239.1    FJ265549    ADI61817.1    KZ150072    PZC74016.1    FJ265542    ADI61810.1    FJ265551    ADI61819.1    FJ265550    ADI61818.1    FJ265545    ADI61813.1    RSAL01000839    RVE41117.1    ODYU01008431    SOQ52031.1    RSAL01002130    RVE40575.1    KZ149985    PZC75698.1    RSAL01000016    RVE53061.1    MRZV01001865    PIK35593.1    AAGJ04144474    GFAC01005640    JAT93548.1    MRZV01002136    PIK34564.1    GEDV01010296    JAP78261.1    GBBI01004876    JAC13836.1    MRZV01000618    PIK46838.1    KZ150485    PZC70710.1    GL440455    EFN65840.1    MRZV01000899    PIK42833.1    FJ265563    ADI61831.1    GDKW01001596    JAI54999.1    FJ265561    ADI61829.1    GBGD01000453    JAC88436.1    FJ265562    ADI61830.1    GBBI01004877    JAC13835.1    UYWY01020264    VDM41049.1    MRZV01000520    PIK48481.1    NWSH01003335    PCG66527.1    NWSH01004509    PCG65028.1    FJ265564    ADI61832.1    JARK01000732    EYC35149.1    JARK01001338    EYC32701.1    EYC32700.1    JARK01001565    EYB89683.1    MRZV01000743    PIK44934.1    JARK01001676    JARK01001446    JARK01001433    EYB83199.1    EYC01126.1    EYC02928.1    JARK01001337    EYC34625.1    GBGD01002934    JAC85955.1    JARK01001354    EYC21986.1    JARK01001626    EYB85834.1    KZ150317    PZC71439.1    JARK01001346    EYC26368.1    JARK01001376    JARK01001370    JARK01001342    EYC14570.1    EYC16380.1    EYC29217.1    MRZV01000640    PIK46507.1    JARK01001396    EYC09581.1    JARK01000807    EYC34984.1    JARK01001434    EYC02684.1    DS268448    EFP02560.1    JARK01000347    EYC38051.1    DS269097    EFP08676.1    JARK01001424    EYC04322.1    KZ149912    PZC78089.1    EYB85833.1    JARK01000460    EYC36749.1    ODYU01004982    SOQ45402.1    DS268650    EFO96957.1    JARK01001621    EYB86109.1    KZ150108    PZC73382.1    GFTR01005437    JAW10989.1    JI178870    ADY48160.1    EYC04323.1    DS269613    EFO86468.1    JARK01001340    EYC30828.1    DS269225    EFP10829.1    JARK01001736    JARK01001462    JARK01001379    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    DS268603    EFO93378.1    MRZV01000169    PIK56634.1    DS269943    EFO90109.1    ODYU01000693    SOQ35892.1    DS268587    EFO92044.1    JARK01001389    EYC11015.1    JARK01001639    EYB85201.1    DS268485    EFP10420.1    DS268497    EFP12149.1    DS268549    EFO89066.1    KZ149907    PZC78256.1    JARK01001415    EYC05859.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF13873   Myb_DNA-bind_5
PF01826   TIL
PF13855   LRR_8
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR028002   Myb_DNA-bind_5       
IPR036084   Ser_inhib-like_sf       
IPR002919   TIL_dom       
IPR032675   LRR_dom_sf       
IPR001611   Leu-rich_rpt       
IPR003591   Leu-rich_rpt_typical-subtyp       
SUPFAM
SSF56219   SSF56219        + More
SSF57567   SSF57567       
Gene 3D

Ontologies

Topology

Length:
223
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.82757
Exp number, first 60 AAs:
0.75605
Total prob of N-in:
0.38513
outside
1  -  223
 
 

Population Genetic Test Statistics

Pi
144.147606
Theta
108.195247
Tajima's D
0.782587
CLR
0
CSRT
0.60121993900305
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号