SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15914
Annotation
PREDICTED:_uncharacterized_protein_LOC105391048_[Plutella_xylostella]
Full name
Galactose-1-phosphate uridylyltransferase      
Location in the cell
Nuclear   Reliability : 3.465
 

Sequence

CDS
ATGGCCAGTCAAGAAATACAGGAACAACTGCAACAACTCTTGGCTGCAAATGCAGCGCTACAAAAACAACTTGAAGGAAATGAGAGAGAAACAAAAGTTTGTAGAGTTACAGTCAAATTGCCTACATTTTGGGCTGACAAACCAGCTGTTTGGTTTGCTCAAATTGAAGCTCAATTCCAAATTGCCAATATTGTGACAGATACTACTAAATATAATTATGTTGTAGGTCACCTTGACCAAAGAATAGCTGGAGAGGTTGAAGACATAATAACAAACCCACCAACTGAAGAAAAATATGAAAAATTAAAAAGCATACTTATTCAGCGCCTTTCTGTATCACAAGAAAAAAGAGTTCGACAACTTCTGAGTGATGAAGAACTTGGGGATAGAAAACCATCACAGTTCCTCCGACACCTACGCTCTCTTGCAGGAAGCACACTCACAGACGACAATATTATACGCCAACTTTGGTTACGCCGCTTGCCTCATCAGGCTCAAGCTATACTGGCAGCACAGGCTGACCTTGGCCTTGACAAATTGTCAGAACTAGCCGACAAAATTCTTGAGTTGGCCCAAACTCCTCCTATGGTATGTTCGACCGCAACATCTTCGAACAGTTTAACCCTTGGTTCATTAGCCAAACAACTAGAAGAGATCAGTAGCCAAGTTGCTGCCCTATCTAGGCGACAGAGCCGCCCTTATCGTGACAGATCATCATCTCGCGGCCCTAAAATTTGTTGGTATCATCGGAGAAATGAAAGGATAGTTGATGGGACCACAGGACTATCATCAATTGCCTCAACCACTGATATTGATCAACCAAGTGTTCGAGCAGTTGCATCTGGAAAGGTCATTTTTACTGAATTATTAGCAGAATTTCCAGACATTACACGACCACCAGGGCTGCCTCGAGTCGTTAAGCACCATACGGTCCATTTCATCAAAACAACGGATGGGCCTCCGATTGCCTGCCGTCCCCGCCGCTTAGCCCCTCAGAAACTAGTTGCAGCTAAGAAAGAGTTCGAGGATATGGTGCAATCTGGTACAGCTCGACCATCCAAAAGTGCCTGGTCATCACCACTGCATATGACAATTAAAAAAGACGACACCTGGCGTCCATGCGGCGATTACCGGGCCCTAAACGCCAGAACAGTTCCAGATAGGTACCCCGTGCGCCATATTCACGATTTTGCTCATAACCTCTCTGGTTCAAAAGTTTTCAGCACCATCGATTTAGTAAAAGCTTATCACCAGATACCGATCGCTGAGGAGGACGTGCCGAAGACAGCAATTGTTACACCGTTTGGCCTCTTCGAATTCCCATTCATGACTTTTGGGCTTCGAAACGCGGGACAGACATTCCAGCGATTTATTGATGAGGTCACACGGGGTCTTGATTTCTGTTTTCCCTACGTTGATGACATCCTCGTTCATTCAGCTGATGAGAATCTTCATCTGAAACACCTTCGAACCCTCTTCGAACGTCTACAAGAATACGGAGTTGTAATTAACCCCTCCAAATGTACTCTGGGAGTAGATGAAGTTAACTTCTTGGGCTATCACATAAACAGTGAAGGGACACGCCCTCCTCGGGCTCGCATCCAAGTCTTATTGGACTTTCCACCTCCTGAGACGGTACAAGGTATGCGCCGATTTCTCGGTATGCTGAACTACTACCGGCGTTTTGTTCCACATGCTGCTCAGTTTCAGGCACCGCTAATTGAGGCTCTCGTAGCAACAAAGAGCAAGGGTGCCAGGCCATTTCCTTGGTCCCCAGAGCTACTTCAGCAATTTGAAGCCTGCAAGCAAAGCTTGTCCTCGGCGACGCTATTACAACATCCTGTGAGTAATTCTAGTTTAGGTCTGTTCACGGATGCCTCCAGTGTTCATATTGGGTCTTGCCTTCAGCAAAAGGTAAATGGTAAGTGGTTTCCGCTATCTTTTTTTAGTAAGAAACTCACACCCCAGCAAAGACAGTGGCCGACTTACTACAGAGAATTATTAGCGGTATACGAAAGTGTTCAACATTTTCGATATATTTTAGAAGTCCAGCATGCCACAATTTTTACCGACCACAAACCACTCTTATATGCTTTCTTACAGAGACGCGAGAAGCTGCCACCTCCTCAGTTAAACCAGTTGTTTTTTATAAGCCAATTCACGACTGACATACAGTATATTAAGGGCGAGGACAATATCGTTGCTGACACAATGTCACGCATCGATATCAACGCCATCGCGCTGGATCAAGATCACGATGCACTCGCGAAGTCTCAGGCTACAGATTCTGAATTGAAAAATCTGTTACAAAATGGCTCTAGCCTGAGCCTAACTAAAATCAGCCCTCCAGAAGCGAAATCGGCAATTTATTGTGACGTTTCTACAGGTAAGCCACGTCCGTATTTGACCCCTTCCTTTCGAAGAACCGCGTTCAACCAACTGCACAACTTGAGTCATCCTGGTATCCGTGCTACCACACGCCTCGTGTCAGAACGTTTCGTTTGGCCATCGATGAAAAGGGACTGCCGTATTTGGTCTCGAAGCTGTGACGCATGTCAACGTAGCAAAGTTTCAAGACACAACTCAGCTCCTACTGGAAACTTTAACACACCATCCGGTCGCTTCATGCACGTGCATATAGACATTGTAGGGCCATTACCGGTTTGCAACGAATACCGATATTGTTTGACGGCAATTGATAGGGTTTCCAGGTGGCCAGAGGTGTGGCCTATGCGCACCATCACGGCAGAGGAAGTGGTGGAAACTTTTACCAGGGAGTGGATTTCCCGTTTTGGAGTACCGTCAATAATCACAACAGACCAAGGATCCCAATTTGAATCCGATTTGTTTAACCGGCTGCTGCTTCGATTCGCCACCAAGCGTATAAGGACTACTTCATATCATCCCTGCGCAAACGGAATGATTGAACGTGTCCATAGACAGCTCAAGGCGGCATTAATATGCCATCAAGATTCATGGATAAGATCCCTTCCCATGGTTTTGCTGGGAATGCGGTCAGCCTTTAAAGAAGATTTGGAAGCCACAGTCGCAGAAACGGTGTACGGTGAACCTTTAAGACTCCCTGGAGAGCTGTTAATAGCTTCCTCGTCAATAGAAAAAATTGAGGATGCCACCGACTTTGTGGTACAATTGCGTAACAAAATGTCATCTATACGCCCAGTGCCTGCTTCTCGACATTGTAAAAACTCTCCATTTATATTCAAGGAATTGGAAAGCGCTTCTCATGTTTTCCTGAGAGACGATACCATCCGCAGGGCATTGCAGCCGCCATATACAGGTCCATATAGAGTATTAGAACGCTCCCCTGATGGGAAAACGTTCACACTGTCCATAAAAAATAACAAAGTTGTCGTGAGTGTAGACAGACTTAAGCCGGCTTTCATAGATCACATTGATGATGAACGGAAGCAAGCCGAGCCTTTGTCTTGTCAGCAAAATCAAGCCTTACGACCAATGGATCTGGAAAATCCGCCGCTATTGCCGCTGCCAACAATGCCGCTGTCAATTCCAATAAAAATTCAAAGTGAGAAAACAAAAGAGCCTTATACCACACGCTCAGGCAGACGTGTCAGATTTAAAAAAATTACTGATTTATAA
Protein
MASQEIQEQLQQLLAANAALQKQLEGNERETKVCRVTVKLPTFWADKPAVWFAQIEAQFQIANIVTDTTKYNYVVGHLDQRIAGEVEDIITNPPTEEKYEKLKSILIQRLSVSQEKRVRQLLSDEELGDRKPSQFLRHLRSLAGSTLTDDNIIRQLWLRRLPHQAQAILAAQADLGLDKLSELADKILELAQTPPMVCSTATSSNSLTLGSLAKQLEEISSQVAALSRRQSRPYRDRSSSRGPKICWYHRRNERIVDGTTGLSSIASTTDIDQPSVRAVASGKVIFTELLAEFPDITRPPGLPRVVKHHTVHFIKTTDGPPIACRPRRLAPQKLVAAKKEFEDMVQSGTARPSKSAWSSPLHMTIKKDDTWRPCGDYRALNARTVPDRYPVRHIHDFAHNLSGSKVFSTIDLVKAYHQIPIAEEDVPKTAIVTPFGLFEFPFMTFGLRNAGQTFQRFIDEVTRGLDFCFPYVDDILVHSADENLHLKHLRTLFERLQEYGVVINPSKCTLGVDEVNFLGYHINSEGTRPPRARIQVLLDFPPPETVQGMRRFLGMLNYYRRFVPHAAQFQAPLIEALVATKSKGARPFPWSPELLQQFEACKQSLSSATLLQHPVSNSSLGLFTDASSVHIGSCLQQKVNGKWFPLSFFSKKLTPQQRQWPTYYRELLAVYESVQHFRYILEVQHATIFTDHKPLLYAFLQRREKLPPPQLNQLFFISQFTTDIQYIKGEDNIVADTMSRIDINAIALDQDHDALAKSQATDSELKNLLQNGSSLSLTKISPPEAKSAIYCDVSTGKPRPYLTPSFRRTAFNQLHNLSHPGIRATTRLVSERFVWPSMKRDCRIWSRSCDACQRSKVSRHNSAPTGNFNTPSGRFMHVHIDIVGPLPVCNEYRYCLTAIDRVSRWPEVWPMRTITAEEVVETFTREWISRFGVPSIITTDQGSQFESDLFNRLLLRFATKRIRTTSYHPCANGMIERVHRQLKAALICHQDSWIRSLPMVLLGMRSAFKEDLEATVAETVYGEPLRLPGELLIASSSIEKIEDATDFVVQLRNKMSSIRPVPASRHCKNSPFIFKELESASHVFLRDDTIRRALQPPYTGPYRVLERSPDGKTFTLSIKNNKVVVSVDRLKPAFIDHIDDERKQAEPLSCQQNQALRPMDLENPPLLPLPTMPLSIPIKIQSEKTKEPYTTRSGRRVRFKKITDL

Summary

Catalytic Activity
alpha-D-galactose 1-phosphate + UDP-alpha-D-glucose = alpha-D-glucose 1-phosphate + UDP-alpha-D-galactose
Similarity
Belongs to the galactose-1-phosphate uridylyltransferase type 1 family.
EC Number
2.7.7.12
EMBL
LBMM01009142    KMQ88359.1    LBMM01012479    KMQ86204.1    LBMM01013040    KMQ85849.1    + More
LBMM01013103    KMQ85815.1    LBMM01012567    KMQ86146.1    GBXI01017046    JAC97245.1    KL367552    KFD64647.1    GBXI01015889    JAC98402.1    LBMM01012160    KMQ86374.1    GBXI01003773    JAD10519.1    KL367492    KFD69854.1    GEGO01003687    JAR91717.1    KL363241    KFD51254.1    LBMM01012134    KMQ86388.1    GDKW01003376    JAI53219.1    GEGO01004484    JAR90920.1    AAGJ04001742    GEZM01017686    JAV90495.1    LN877232    CTR11708.1    GGLE01003443    MBY07569.1    EF426679    ABP48077.1    GEGO01004649    JAR90755.1    KQ973093    EFA13472.2    ABLF02030693    ABLF02030697    GFPF01012375    MAA23521.1    LBMM01001181    KMQ96765.1    GEGO01003506    JAR91898.1    GFDL01003994    JAV31051.1    GGLE01001814    MBY05940.1    GEGO01004686    JAR90718.1    MRZV01001828    PIK35719.1    GEGO01004475    JAR90929.1    GGFK01003401    MBW36722.1    GGFK01003442    MBW36763.1    GEGO01000286    JAR95118.1    GDHF01001116    JAI51198.1    AAGJ04164195    AAGJ04164196    AAGJ04164197    GEGO01001281    JAR94123.1    GDHF01021808    JAI30506.1    KL367519    KFD67051.1    GDHF01014424    JAI37890.1    AAZX01009606    AAZX01006801    AAZX01023483    AAGJ04130731    GACK01008900    JAA56134.1    KQ971355    EFA07205.2    FN356213    CAX83702.1    BN000785    CAJ00226.1    LBMM01012633    KMQ86092.1    IAAA01040175    LAA10459.1    GBHO01015475    JAG28129.1    GGMR01005228    MBY17847.1    KL367544    KFD65142.1    KL367778    KFD59660.1    GEDV01001796    JAP86761.1    KL367655    KFD60653.1    BN000802    CAJ00250.1    BK004070    DAA04500.1    CABG01000050    CAZ37786.2    KL367543    KFD65158.1    AAZX01004786    AAGJ04112098    KL367664    KFD60497.1    RQTK01000577    RUS77485.1    GBYB01009311    JAG79078.1    ABLF02040931    ABLF02040938    KL367479    KFD72009.1    AY013569    AAK07487.1    ABLF02006352    ABLF02013150    ABLF02013854    ABLF02041505    DF142933    GAA49140.1    AAGJ04000250    AY013565    AAK07486.1    ABLF02011086    ABLF02042879    AY013563    AAK07485.1    LBMM01008151    KMQ89105.1    KZ149973    PZC76007.1    AAZX01023279    BK004066    DAA04495.1    CABG01000001    CCD58591.1    ABLF02058233    QPMK01000035    RDD64024.1    AAZX01023264    KL363454    KFD45607.1    NIVC01003188    PAA52757.1    ABLF02005645    ABLF02042063    KL363200    KFD55431.1   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00665   rve
PF17917   RT_RNaseH
PF01087   GalP_UDP_transf
PF00176   SNF2_N
PF00271   Helicase_C
PF05918   API5
PF13359   DDE_Tnp_4
PF00077   RVP
Interpro
IPR036397   RNaseH_sf        + More
IPR041588   Integrase_H2C2       
IPR000477   RT_dom       
IPR012337   RNaseH-like_sf       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR001995   Peptidase_A2_cat       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001969   Aspartic_peptidase_AS       
IPR034132   RP_Saci-like       
IPR041373   RT_RNaseH       
IPR005849   GalP_Utransf_N       
IPR019779   GalP_UDPtransf1_His-AS       
IPR001937   GalP_UDPtransf1       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036265   HIT-like_sf       
IPR013032   EGF-like_CS       
IPR016024   ARM-type_fold       
IPR014001   Helicase_ATP-bd       
IPR001650   Helicase_C       
IPR008383   API5       
IPR038718   SNF2-like_sf       
IPR027417   P-loop_NTPase       
IPR000330   SNF2_N       
IPR027806   HARBI1_dom       
IPR018061   Retropepsins       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF54197   SSF54197       
SSF56219   SSF56219       
SSF52540   SSF52540       
SSF48371   SSF48371       
PDB
4OL8     E-value=1.42477e-64,     Score=630

Ontologies

Topology

Length:
1205
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.000780000000000001
Exp number, first 60 AAs:
0.00022
Total prob of N-in:
0.00004
outside
1  -  1205
 
 

Population Genetic Test Statistics

Pi
22.136533
Theta
36.642516
Tajima's D
0.282457
CLR
29.750848
CSRT
0.457127143642818
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号