SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15908
Annotation
PREDICTED:_uncharacterized_protein_LOC105700222?_partial_[Orussus_abietinus]
Location in the cell
Mitochondrial   Reliability : 1.554 Nuclear   Reliability : 1.98
 

Sequence

CDS
ATGGTGAAGACAAGACTAGGAACAGACACCGACATGGCGACGTCTTCGACAAATGGTACGACCGCCGCTGCTGACCAGACCGGGCGAGACCGACAGTCCGTCCACAGCAGTCGCGCACCGTCACCGACCGCGTCTGTCCGGTCCACCGTCTCCAGTGCAATGACTCAGATTCGACGACAAAAACTAATACAACTAAAGTTGGACGCTGCCGAACAACGCGCACGACTACACTTGCAGCTTCTGGAGGAAAAACTAGCCATCGAAAGTCAGGCCCTAGAAGAGGAAGAAGATCCGCTGACATGCAATCTACCAGGTAACTCTCAAACATTACCAAACGCACATGACGTAAGATTACCGGCTTGCTGTCAGCAAAATTCAGAAGAGAATGAGCTAGCAAACTGCGTAACTAAGCTCCTCGCAAGACAGTCAAGTACTCGAGAATTGCCTACGTTCTCTGGTGAGCCCGAGGAATGGTCTCTTTTTTATAGTCAATTTACATCGACAACAAAATTATGCGGCTATAGCGATGACGAGAATATAGCCCGACTCGCGCGATGTTTGAAGGGACGAGCACGTGACGCAGTGTACGCGCTTCTTGTTAGCGCTAGCAATCTCGATCGCATTATCAGCACATTAAAATTACGTTTCGGCCGACCAGAAAATATCATCGAAATTTTATTGAATAAAATTCATGCAATACGTGACATACGTCACGACGACATAGACCGTCTAATAGAGTTCGCGACGGCTGTGCAAAATGTCACGGCGACTATGAAATCAACCGAAGAAATAGGACATTTAATGAATCCAACGTTAATACGAGAAATTGTCAGTAAGCTGCCATCGACGTTACGATATCAATGGGCGATACATGCAGCGAGCTTAGGCGTGAAGACCGTCACGCTGTCACATATATCGGAGTGGCTTATGACAATGGCCAACGCTGCTTCATTCATCAGTCCTCTGACCACCAAGACGTCTAGTGATGTGAAACCACCGACCAGACCGGATCCTAGACTTTGGAGACCAGCAGTGATGGCGACGACTCCAACGGCAGTAAATTTATCCTGTACTCTTTGCGGCGATGCGCATGACATACAAAGCTGTGAGAGGTTCATACAGATGACGACAGACGATCGTTGGAGATTCGTAACTGAGAAGAAGTTGTGTTTTTCATGTTTGTCCAGCCGACATCAATTAAGGGCTTGTGAAAAAAAGACGAAGTGTGCTGTTCGCGACTGCATGAGGGTTCATCACACTTTGCTCCACGCTGTGCGACGCGTCATGAAGATTGATAATGCTGTCAACCACACGGACAATACCGTTAATACTCTCAACAGTGCGGATCGGCATGTATTTTTAAAAGTGGTTCCAGTTGTAGTATCCGGAGCGAAAGGTGACGTGCTGACCTATGCACTTTTAGACGAGGGAGCAGCAGTGACACTCGTGAACTCGTCACTTCTGGAGAGAGCTGGCATCACTGGACCGACGTCGAGCCTTCGCATCCGCGGCGCGTCCGGCATGACAACCATCGAACCGAACTCTAGACTAGTTTCTTTTAATATTCGCGGAGTAAATGTATCAAATGTATATAATGTAAATAGTGCACGTTCTGTAAATAATCTTAATATATGTGTAGATAGTTTTAGATATAAGAAAATTGTAAACAAATATCCGTGGGTGACTGACTATGTAACTGACTATGACATACGGCCTGACATGATTGAACTTCTTATTGGACAAGACAACATTGATTTGATTATTACTAGACAGATAATACAAAGACATAAGACTGGACCAATAGTTTCTAAGACTGACTTAGGCTACGTAGTTCATGGAAATGTAGGACTGGGTAGTGTACCAGACGATGCAACTGTTTTACATTCTTGTCGATGCGACGAACTACACGAGCTGGTCAAGCAGTCTTTCTCCACAGACTCGTTTGGCGTTAAGCAGACTAACGACTTTCCTCGTTCTCGAGAGGATCAGCTAGCGCTGAGCATCATGGAGCGAACCACTAAGCTCTTACCCGAAGGCAGGTGGGAGACTGGCCTGCTTTGGAAGTCTGACGATCTTCAGCTGCCGGACAGCCTACCGTTGGCTATGAGCCGACTCAACGGTGTCCAGAAGAAAATGGTGAAGTACCCAGAGTTTGCTTCTCAGTACAGGTCTAAGATAGAAGAGAATTTGGACAAAGGGTACATCACGAAAATTCAACCAGGAGATCCTGCGACTAAGACTAGGATCTGGTACTTGCCGCATTTTGCAGTCTTCAACCCCAACAAACCGAACAAGCTGCGGATTGTTTTAGACTGTGCTGCGAAGTCTGGTGGTAAGTCATTTAATGATTTCCTACTGCGAGGACCTGACTTTTTGACATCACTACCAGCAGTCTTATTAAAGTTCCGGACAGGAAAGTTTGCTGTGACAGCGGACATACAGGAAATGTTCCACAGAGTTCTCATCCGACCGGAAGATAGACATGCTCAGAGAATTTTGTGGGATGGCGAAACTTACATCATGAACGTCATGACCTTTGGTGCTGTATGCTCGCCGTCATCAGCACAATTTGTTAAAAATATAAATGCTCGTAGGTATGAGACGACAAAACCTGAAGCATATAAAGCAATTGTTGATCACCACTATGTCGATGATTATATCCACTCTTTCGATCATGAAGATGATCTGATCCGGGTGGTGGATGACGTGGTACACATTCATGTTTCAGGTGGGTTTAACTTACGTAATTTTGTATCGAACTCAAAACGTTTACTAGCTCATTTACCGGCTGAGAAACTTGCCCCGAGCTGTCTGAAAATCCTCTCAGACGTTAAAGATGACCAGGTTGAAAGAGTACTCGGAGTGCGTTGGGATCGAGAGACTGACGAATTTCTATTTCATTTGAAGTTCCCGAAGGTGAGCGAAGCTATTAAGACAGGCATTAAAAGACCGACTAAACGCGAAGTGATGAGACTTATTATGTCTCTATTTGACCCGTTAGGTTTTTTGCTTTACGTCACCGTGAAGGGTCGTATTCTGCTGCAGACCATATGGAAGTCAAATGTTGGTTGGGATGACGAAGTTGAGCTTAGCCAGTTTGAAAAATGGCAGTCTTGGTTGACTGAGCTTCAAAAGACCAGTGAATTCAGGACTCCACGTTGGTTGTTTAACGATGGATGTGGCAAGCAAGAACCGCCAGAACTTCATATTTTTTGCGATGCAAGCAGCAAAGCTTTCGCCAGTGTGGCATATTTACGAGACAAAACGACTGATGGCAAATGGCACGTGTCTTTTGTCATTGCACGCGCACGTGTTGCACCTCTTAAAGTGATGAGTATCCCTCGACTTGAGCTACAAGCTGCGCTTATGGGTGCAAGACTAGCTCACACTTTGAAGAAAAATATAGACGTGAGTACCGTGACCTACTGGTCTGACTCAAAGACCGTGTTAAGTTGGCTTAGGTCTGACAGTGGCCGTTTCAAGCCTTTCGTAGCCCATCGCGTCAGTGAGATTTCTGAGCTGACTGAGGTCAGTCACTGGAGGTGGGTACCTTCAGGACTAAATGCTGCAGATGACGCCACAAGGGAGACTGTTGCCGAGGACAACACACGATGGATGAATGGACCGTCATTTCTACGTGAGCCCAAAGAGACCTGGCCACAAGATGATTCTGTCATAAGTCTGGACCCTGACGACGTCGAGGTTAAGGTTAACACCATTACTCTAATGACTGTAGAGCTACCCGATGACAGTCGTTTTTCCCGATACTGGAGACTTATCAGGAGCACCGCTTGGTTTATGCGTGCAGTACACAACTGGATGCACAAGAGTAGCAAGCGACACGGTGAGTTGACAGCCGACGAAGTTAAAGTAGCGGAGCTAATCTGGATTAGAGAAAGCCAAAGACGAATGTTCTCAGACGATATAGAAAGTGTCAAGAAAACCGGACAAGTGAAGCGAGATTCTCCGCTCCGTCAGCTTACACCATTTTTAGACAAGGACGGCATCCTCCGTGTTCGTGGGAGGATCTGCAGAGCAGATGGTGATAACGATTTCAGGCACCCTATAATTTTGAATCCAAAAGACAAATATGTCAAATTACAACTTATGCAGTATCACGTGGACTCAGCACATAATGGACGCGAACGTGTGCTGCATGAAGTGAGACGACGATTCTGGATAATAAATGGACGTAATGCAGTAAAGATGACATGGAATGACTGTCAGTTCTGCAAGAACAGTCGTGCGAAGCCCTCGCCACCACTCATGGCTGATTTACCAGATGTTAGATTGAAGGAGGTCAGTCGACCTTTCACTTACACCGGGTTAGATTATTTCGGTCCAATTATAGTGAAGGTTGGACGTAGACACGAGAAAAGATGGGTAGCACTATTTACATGTCTGACAGTTCGCTCTATCCATCTGGAGTTGGTTCACGATTTGACAACCAGCTCCGTGTTGATGAGCCTCAGACGGCTGATAGCGAGACGAGGCTGTCCAAGTATTATTTTCAGCGACAACGCGACTACCTTTCGTGGGGCTGACCGTGAACTGAAGCGAGCTGTACAAGCTATCGACAAAGACGAACTCATCACCTTCGGTAGCCTCCGACACTTGGAGTGGCGATTCATAGCCCCTGACGCACCTCATATGGGTGGATGCTGGGAGCGGCTCGTGAGATCCGTCAAAACAAGCTTGCGAGTAACGCTCAAGACCAGAACACCTAACGATCAGACTTTAATGACACTCCTGGCTGAGGCTGAATTCATGGTGAATTCAAGACCACTGACATACGTACCTCTTGATTTTGACGACGACTTGCCCTTGACTCCGAATGATTTTTTACTACCAAAGACAGAATTTATTGACCATCCTTTCGGAATGTTTACGGACCATGATTTACTGAAACGGACTTGGAGAGAATCTCAACGACTTGCAGACTTGATTTGGAAACGCTGGGTCAAGGAGTACTTGCCCACTTTGACACGACGAGACAAATGGTACAGAGATTCTGACAGACCACTGGCGATTGGTGACGTCGTAGTTGTTGTTGACTCCCAGCTACCCCGCAACCAGTGGCCGCTTGGCAAGATCGAGCAGGTCTTCCCTGGTAAGGACGACATGGTTCGCGTTGCTAAAGTTCGGACCAGACATGGACTCTACACAAGACCGGCGACGAAACTGTGCAGGTTGGACGTACACTCCTCATCTTGA
Protein
MVKTRLGTDTDMATSSTNGTTAAADQTGRDRQSVHSSRAPSPTASVRSTVSSAMTQIRRQKLIQLKLDAAEQRARLHLQLLEEKLAIESQALEEEEDPLTCNLPGNSQTLPNAHDVRLPACCQQNSEENELANCVTKLLARQSSTRELPTFSGEPEEWSLFYSQFTSTTKLCGYSDDENIARLARCLKGRARDAVYALLVSASNLDRIISTLKLRFGRPENIIEILLNKIHAIRDIRHDDIDRLIEFATAVQNVTATMKSTEEIGHLMNPTLIREIVSKLPSTLRYQWAIHAASLGVKTVTLSHISEWLMTMANAASFISPLTTKTSSDVKPPTRPDPRLWRPAVMATTPTAVNLSCTLCGDAHDIQSCERFIQMTTDDRWRFVTEKKLCFSCLSSRHQLRACEKKTKCAVRDCMRVHHTLLHAVRRVMKIDNAVNHTDNTVNTLNSADRHVFLKVVPVVVSGAKGDVLTYALLDEGAAVTLVNSSLLERAGITGPTSSLRIRGASGMTTIEPNSRLVSFNIRGVNVSNVYNVNSARSVNNLNICVDSFRYKKIVNKYPWVTDYVTDYDIRPDMIELLIGQDNIDLIITRQIIQRHKTGPIVSKTDLGYVVHGNVGLGSVPDDATVLHSCRCDELHELVKQSFSTDSFGVKQTNDFPRSREDQLALSIMERTTKLLPEGRWETGLLWKSDDLQLPDSLPLAMSRLNGVQKKMVKYPEFASQYRSKIEENLDKGYITKIQPGDPATKTRIWYLPHFAVFNPNKPNKLRIVLDCAAKSGGKSFNDFLLRGPDFLTSLPAVLLKFRTGKFAVTADIQEMFHRVLIRPEDRHAQRILWDGETYIMNVMTFGAVCSPSSAQFVKNINARRYETTKPEAYKAIVDHHYVDDYIHSFDHEDDLIRVVDDVVHIHVSGGFNLRNFVSNSKRLLAHLPAEKLAPSCLKILSDVKDDQVERVLGVRWDRETDEFLFHLKFPKVSEAIKTGIKRPTKREVMRLIMSLFDPLGFLLYVTVKGRILLQTIWKSNVGWDDEVELSQFEKWQSWLTELQKTSEFRTPRWLFNDGCGKQEPPELHIFCDASSKAFASVAYLRDKTTDGKWHVSFVIARARVAPLKVMSIPRLELQAALMGARLAHTLKKNIDVSTVTYWSDSKTVLSWLRSDSGRFKPFVAHRVSEISELTEVSHWRWVPSGLNAADDATRETVAEDNTRWMNGPSFLREPKETWPQDDSVISLDPDDVEVKVNTITLMTVELPDDSRFSRYWRLIRSTAWFMRAVHNWMHKSSKRHGELTADEVKVAELIWIRESQRRMFSDDIESVKKTGQVKRDSPLRQLTPFLDKDGILRVRGRICRADGDNDFRHPIILNPKDKYVKLQLMQYHVDSAHNGRERVLHEVRRRFWIINGRNAVKMTWNDCQFCKNSRAKPSPPLMADLPDVRLKEVSRPFTYTGLDYFGPIIVKVGRRHEKRWVALFTCLTVRSIHLELVHDLTTSSVLMSLRRLIARRGCPSIIFSDNATTFRGADRELKRAVQAIDKDELITFGSLRHLEWRFIAPDAPHMGGCWERLVRSVKTSLRVTLKTRTPNDQTLMTLLAEAEFMVNSRPLTYVPLDFDDDLPLTPNDFLLPKTEFIDHPFGMFTDHDLLKRTWRESQRLADLIWKRWVKEYLPTLTRRDKWYRDSDRPLAIGDVVVVVDSQLPRNQWPLGKIEQVFPGKDDMVRVAKVRTRHGLYTRPATKLCRLDVHSSS

Summary

EMBL
LNIX01000019    OXA44855.1    LNIX01000015    OXA46575.1    LNIX01000003    OXA57597.1    + More
LNIX01000039    OXA39294.1    LNIX01000007    OXA52015.1    LNIX01000004    OXA55241.1    GAMC01017930    JAB88625.1    GGFL01001682    MBW65860.1    GEZM01052586    JAV74401.1    JXUM01127084    KQ567147    KXJ69602.1    LN877231    CTR11689.1    JXUM01136032    KQ568367    KXJ69026.1    GGFL01001842    MBW66020.1    JXUM01111221    KQ565482    KXJ70922.1    RSAL01000375    RVE42106.1    AF530470    AAQ09229.1    JXUM01130316    KQ567562    KXJ69370.1    GDHC01018323    JAQ00306.1    GEHC01000921    JAV46724.1    AB110069    BAD01589.1    BAD01590.1    GGFJ01000306    MBW49447.1    GGFL01005193    MBW69371.1    OXA56382.1    GEHC01000947    JAV46698.1    GGFJ01000333    MBW49474.1    KQ459986    KPJ18861.1    JXUM01038372    KQ561162    KXJ79503.1    OXA56250.1    GGFJ01000218    MBW49359.1    GGFJ01000302    MBW49443.1    GEHC01000967    JAV46678.1    GEHC01000945    JAV46700.1    GEHC01000914    JAV46731.1    KL367480    KFD71819.1    GGFJ01000432    MBW49573.1    AAGJ04115911    AAGJ04043389    GGFJ01000471    MBW49612.1    GGFJ01000470    MBW49611.1    GGFJ01000487    MBW49628.1    GEZM01052587    JAV74399.1    GDIP01036233    JAM67482.1    GDIP01004568    JAM99147.1    AAGJ04040339    AAGJ04095911    GEHC01000913    JAV46732.1    GAMC01020598    GAMC01020596    GAMC01020592    JAB85959.1    GDIQ01002920    JAN91817.1    GDIP01030392    JAM73323.1    GDIQ01002921    JAN91816.1    GEHC01000955    JAV46690.1    JXUM01005879    KQ560203    KXJ83865.1    GEHC01000872    JAV46773.1    KL367737    KFD59786.1    KL367527    KFD66131.1    JYDN01000258    KRX52286.1    AAGJ04001285    FN356218    CAX83707.1    JYDO01000040    KRZ75306.1    AAGJ04058558    AAGJ04091218    JYDS01000555    KRZ02797.1    JYDP01000296    KRZ01365.1    JYDT01000008    KRY92224.1    JYDU01000375    KRX86446.1    JYDV01000070    KRZ36622.1    KRZ75294.1    KL367570    KFD63600.1    BK004068    DAA04498.1    JYDV01000007    KRZ44161.1    JYDM01000405    KRZ82011.1    JYDM01000406    KRZ82010.1    HAEJ01004007    SBS44464.1    JYDM01000410    KRZ82006.1    JYDK01000180    KRX73317.1    AAGJ04173907    JYDO01000345    KRZ65499.1   
Pfam
PF01565   FAD_binding_4        + More
PF17921   Integrase_H2C2
PF18701   DUF5641
PF05380   Peptidase_A17
PF09129   Chol_subst-bind
PF03564   DUF1759
PF00665   rve
PF05585   DUF1758
PF00078   RVT_1
PF00628   PHD
Interpro
IPR001878   Znf_CCHC        + More
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR001584   Integrase_cat-core       
IPR016164   FAD-linked_Oxase-like_C       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR005312   DUF1759       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR040676   DUF5641       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR008737   Peptidase_asp_put       
IPR000477   RT_dom       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR002999   Tudor       
IPR019786   Zinc_finger_PHD-type_CS       
IPR001841   Znf_RING       
IPR000253   FHA_dom       
IPR001995   Peptidase_A2_cat       
IPR021109   Peptidase_aspartic_dom_sf       
IPR036875   Znf_CCHC_sf       
IPR001969   Aspartic_peptidase_AS       
IPR013087   Znf_C2H2_type       
SUPFAM
SSF53098   SSF53098        + More
SSF56176   SSF56176       
SSF55103   SSF55103       
SSF57903   SSF57903       
SSF57756   SSF57756       
PDB
3S3O     E-value=0.0593277,     Score=91

Ontologies

Topology

Length:
1737
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.14515
Exp number, first 60 AAs:
9e-05
Total prob of N-in:
0.00131
outside
1  -  1737
 
 

Population Genetic Test Statistics

Pi
68.34671
Theta
26.627386
Tajima's D
0.263434
CLR
316.288879
CSRT
0.450077496125194
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号