SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15906
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.372 Nuclear   Reliability : 1.366
 

Sequence

CDS
ATGTTTTACGGGTGCCGCGAACTAAGAAGACTGCACACCGTGTTCCCTTTTCCCACCTTTGCTAAGCAAAGGGTGCGTGAAGAGGGAGAGGGCTCCCTTCTGGAGCCCTCCTGTATGCTAGGCCATGTCCCCGGCGGCTCTCTGGCTGTTAAAGGGGAAGGCCCTCCAGAGGGGGGTACCGGAGGGTACCACCTTAGGTGGAGAATCCCTCCGTGCTTCCACCTCGGTGGGAGCACGCTGCCCCGCGTATTCTGGGGGGGCAAAGAATGCCAAGATGAAGGGGGCTGTGCGACGGGCAGCGGAAAACCCGTCGAACCGAGGTGTGCCAGCGCTGGCTCGACGCGCTCTGCGCTCGTCAGCGACGGCGAGGCAGTTGATCCAAAAGGGACAACCGCCAAGAAGATCAGGCGGAAGAGGAAGTCGTGGCGAGTTTCCTCTCGTGAGGGGGTAGGGGAGCCAGCGTCGTCCTCTGGTGCGGATGCCCCACCGGAGAAAGTGCTGGTAGTCTCCGAAGCGGCCTCTGCTGCGGAGGAGATGCCGCCCCCTAAAGGGAGACCCGCCCGTAGAAGAGGCGCACCGTCACCGGCACCATCATCAGTGTCGATGTCTGTCGCCTCACTAGACGGGCAGACGACGGAGGAGGAAGAGGGTGGTCTTCAGGACCCTGCCTTGGTCATAGACAGGGCCATGAAGACCATCAAATCATATGCGGCCAACGGCACCAAAACCAAAGCTGCTGGCCGAAAACTGCGAGAAGTGGTCTCGCAGGTCTCGAAGGTTCTGCCTTCGGTTGCTTCTGCCAATGACCAGGTAGTACAGCTGATGGCGGAAAATTCGAGGCTTCGAGCACAGCTTCAAGCACAGCAGCAACCCAATGACGGCGCAGCGACGCCTTGGGCTACTGGAGCCCCTCGGGGCCCCCGTCCCCCGGCGCTGACTGGCGACCGATGGCCTGTGCTGCCACCACCGCGTGTGGCACAACAGCGGCCGCGTCTCCCGTCACCGCGCTCTAGGGAGACGTCCGCCGCCGAGCGACGGCGGACACTCGCGGGGCCACGGATGTTGGCTCCGCCAGAACCAGCAAACTTCAGCCTGGACGAGGTCATCAGCCGCACTGTCCAGGCTGTAATAGAAAGGCTGGGCGGCAGGTTGGCAGCTCTCGAGGCGAAAGTCTCGGTCTCGGCTGACACTAGGCGGCCGGCGGTGTCGGGTGCTTTGGCCACTCGTCCTGCTCCCGTACGAGCTCCGGCCACCAAGTCGGGCCCGGGACGGGCTAAAACCAAGCGAGGGGGTGGCGCTATAGCGAATCCTCCACTACAAGCACCCCAGTCCCGTCCACTGCCTCCGCCTCCGTCAAATATGGACGAGGGGTGGAACGTGGTGGCCAGGCGGGGCACCAGAAAGGCCCCACCGGCAGCTCCTCAAATGGGTAGAGCGCCGGCGGCCAAGGCGGCTCAAGCTGCACCCCAACAGGGTCGAGCGTCTGAAGCCGCCAAGAAAAACCAAAAAAAGAAGTTACCGCGCGCGCCTCGGTCGGCAGCAGTGGTTCTTACCCTACTGCCAGCCGCTGAAGCCAAGGGCATGACATACAGAGATGTCATCGCCCGGGCGCGTGCGGCAGTTGACCTGGGCGAGATTGGGGCGGAGGAGGGCCTCCGCTGCAGGCAGACGGCCAACGGGGCCAAGCTGCTAGAATGTCCCGTTGCCGATAGTGCCGGCATCGCGGAGCGTCTGGTGGCGAAGCTCCGTATGGTCCTACCTGAGGAGGAGGTGCGGGTGCACAGGCCGGTGAAAATGGCCGAATTAAGAGTAACCGGCCTGGACGACTGTACCACCAGGGATGAGGTGATGGCGGCTGTCGCTGTCCAGGGCAAATGCGCACTGGAAAATGTAACCGTAGGCGAGCCGCGCCGCGGTTATACCGGGGCCAGCTCGGTGTGCACCAGCTCGGTTGACCGCAGCGGTCTATGTTTCCGCTGCGGCCAACCTGGTCATAAAGCGGCGTCCTGCACGGCCGCCCCGCACTGCGCTCTGTGCGCTGCGGCCGGGCGTAGGGCAAACCACCGGGCGGGAGGCAAGGCTTGCTTCCCGTCCGGTGTTAATACTGAACGCAACCGGCGCCGAAAATCAAGGCGCCGGCAGAAGAGAAGGTTGGCCAGAGGAGCACTGGCCAATGTTGCAATCCCCGCTGCGGCGCCGGTGCCGGAGGGTGGGGGCAGCGGAAACCTGAACCACTCCGCCAGAGCTCAGGACATGCTGTCTCAGAGCATGGTGGAGTGGTCCATAGACGTGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCGGCAAATGATTGCTGGTTCGGGGACGATGGCGGCCTGGCGGCCATAGTCATAAGAAGAGACGCGACGATCCCCCCCTTGGCGATGGTGACCAGGGGCCAAGGGTTCGTCGCGGTGCAGCTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAATAGGCCTACTGTCGAGTTCGGGCATTTCCTGGACGGGATCGGGGCGATTGCTCGCCGCCTCGCTCCTCGTCCAGTGATTCTCGCGGGGGACCTCAATGCGAAAGGGTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCGAGCCCGGCCATCGCGCGCCGTATTCGCGACTGGAGGGTTCTGGAGGGGGCGGAGACGCTGTCAGATCACCGGTATATTCGATTTGATCTCTCCGCCCGCTCCACAGTCGCGGTCGCCTACGGGGACCACCCCCGTGGTGCATCCCGGTCATTCCCCAGGTGGGCACTGAAGCGCTTGAATAAGGCGCTACTGATGGAAGCTTCTACGGTGGCGGCGTGGGCGCCCATGCGTCCACATCCAGTTGAGGTCGAGGACGAAGCGGGGTGGTTCCGGGACACGATGCGTCGCATCTGTGACGTGTCGATGCCCCGGATTAGCCCTCGACCTCCCAATCGCCAAGTGTACTGGTGGTCGCCCGAAATCGCGCAACTCCGTGTGGAGTGCGTTCGGGCGAGGCGCCAGTGTGCGAGGCATCGCCGCCGTCGCCTGCCGCGGCGCAACGATCCGGTGGCGTTCGCGGTGGTAGAGGCCCAGCTGTACGGCGCATTTCGCGTCGCACAGAGGGCGTTGCAGCTGGCCATCAGAAGAGCCAAGGACCAACACATGGAGGGTCTCCTGGAGACGCTGGATGAGGATCCGTGGGGGCGACCCTATCACATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCAATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCAGGGGGGATTTGTCGCTCCCGCTATGGGCGCGCCGCCGGAATACGACGGCGACGCCCCTGCTGAGGTGCCCCATATAACAGGGGCGGAGCTCCGTGTGGCAGTACGCAAAATGTGCGCAAAGGACACTGCACCTGGCCCGGACGGCGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGACTTTATAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTTGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAACTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTGCTCGGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTGGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTGCGGGGGTGGGGTGGCCTTGGCGGTGTCGCTCGACATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAAAGACACGGAGTGCCCCTCTACCTTCGCCGGCTGGTCGGCTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGGTCGTGCATCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTACTCGGCCCTCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGGGGTGCCCTCCTCCCGGGCCTAAGCGTAATCTGTTACGCAGACGACACGCTGGTCGTGGCCCGGGGAGGGAGCTTTGCTGAGTCTGCTCGTCTTGCCACCGCTGGGGTAGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGGATCGGGGTCGGGGTGCAGTTAAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCATTTTCAGCACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTTCCCAACATCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGGTCAATGGCCTTATACGGGGCACCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCGAAGTTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCTTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTCCTGGAGGCGGAGGCGCTCGCTGCTGACTATCAGTGGCGGGCTAACCTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCTGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGATTCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGGGTGTTACCATTGTGGTTGCGACTTGGATACGGCGGAGCACACGCTCGTTGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCGAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAAGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MFYGCRELRRLHTVFPFPTFAKQRVREEGEGSLLEPSCMLGHVPGGSLAVKGEGPPEGGTGGYHLRWRIPPCFHLGGSTLPRVFWGGKECQDEGGCATGSGKPVEPRCASAGSTRSALVSDGEAVDPKGTTAKKIRRKRKSWRVSSREGVGEPASSSGADAPPEKVLVVSEAASAAEEMPPPKGRPARRRGAPSPAPSSVSMSVASLDGQTTEEEEGGLQDPALVIDRAMKTIKSYAANGTKTKAAGRKLREVVSQVSKVLPSVASANDQVVQLMAENSRLRAQLQAQQQPNDGAATPWATGAPRGPRPPALTGDRWPVLPPPRVAQQRPRLPSPRSRETSAAERRRTLAGPRMLAPPEPANFSLDEVISRTVQAVIERLGGRLAALEAKVSVSADTRRPAVSGALATRPAPVRAPATKSGPGRAKTKRGGGAIANPPLQAPQSRPLPPPPSNMDEGWNVVARRGTRKAPPAAPQMGRAPAAKAAQAAPQQGRASEAAKKNQKKKLPRAPRSAAVVLTLLPAAEAKGMTYRDVIARARAAVDLGEIGAEEGLRCRQTANGAKLLECPVADSAGIAERLVAKLRMVLPEEEVRVHRPVKMAELRVTGLDDCTTRDEVMAAVAVQGKCALENVTVGEPRRGYTGASSVCTSSVDRSGLCFRCGQPGHKAASCTAAPHCALCAAAGRRANHRAGGKACFPSGVNTERNRRRKSRRRQKRRLARGALANVAIPAAAPVPEGGGSGNLNHSARAQDMLSQSMVEWSIDVAVVAEPYFVPPANDCWFGDDGGLAAIVIRRDATIPPLAMVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLDGIGAIARRLAPRPVILAGDLNAKGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSTVAVAYGDHPRGASRSFPRWALKRLNKALLMEASTVAAWAPMRPHPVEVEDEAGWFRDTMRRICDVSMPRISPRPPNRQVYWWSPEIAQLRVECVRARRQCARHRRRRLPRRNDPVAFAVVEAQLYGAFRVAQRALQLAIRRAKDQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQEQGGFVAPAMGAPPEYDGDAPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLLGVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVCGGGVALAVSLDIANAFNTLPWSVIGGALERHGVPLYLRRLVGSYLEDRSVTCTGHGGVVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQHLVPRLLGVAGALSRLLPNIGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRANLRARGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPILVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAGCYHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADLAQALAL

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.000106984,     Score=115

Ontologies

Topology

Length:
1761
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.14733
Exp number, first 60 AAs:
0.0002
Total prob of N-in:
0.00007
outside
1  -  1761
 
 

Population Genetic Test Statistics

Pi
19.98998
Theta
143.246244
Tajima's D
0
CLR
30.086978
CSRT
0.371781410929454
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号