SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15905
Pre Gene Modal
BGIBMGA013400
Annotation
PREDICTED:_microtubule-associated_serine/threonine-protein_kinase_3_isoform_X3_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.802
 

Sequence

CDS
ATGCTAGCCCTAAGCCCACTACCGTCACATTTGGTAGAAAACAGTCAGAAGTACGAAATTAACAAAATTGAGACGGAAACTGACATAGATAAAGAACTTTGTGAAAATTTAAAGAAAATTCGTACCAGCCACATGAACGAGGAAGAAAAACGGGAAATTACTAAAATCTGCTATCAGTACCGTGACATATTCTACTCGGAAAACATTCCTTTATCGTTTACCCATACAGTAAAACACGAATTAAGACTAACCGACGACACCCCCATCTTTGTACGAAGTTATAGACAGGCTCCCCAACAACGAACAGAGATACAGAAACAGGTAGATAGTCTGTTAAAACAAGGAATCATTAGGGAAAGTATCTCCCCTTGGTCGTGCCCGGTACACATTGTTCCGAAAAAACCGGATGCATCAGGAAAAGTTAAATGGAGACTTGTTATTGACTATAGAAGACTTAATGACAGAATTATAGAAGACAAGTACCCCTTACCAAACATTAACGACATCCTTGACAGATTAGGGCGCGCACAATATTTCACGACCATAGATTTAGCAAGCGGCTACCATCAATTAGAAATGCACCCTAAAGACGTAGAGAAAACAGCGTTTACTACCGAAAGAGGCCACTATGAGTTCCTAAGAATGCCTTTCGGACTAAAAAATGCCCCGAGCACATTCCAGCGTCTTATGGACCATATACTCCGAGGTATAGACAACGTATTTACGTACTTAGATGACGTCATAATAGCCGCGACGTCCCTACAAAACCACAATGAAAAACTGAAATTAGTATTTCAGCGATTCAAAATGCATAATTTGAAAGTTCAGTTAGACAAATCAGAATTTCTACAGAAGCACGTTAACTTTCTAGGACATGAATTGACTGACCAAGGACTAAATCCTAACAAGGACAAAATTAAAGCAGTATTAAATTTCCCTATACCACAAACGCAAAAAGACATAAAAGCTTTCTTAGGACTAGTCGGGTACTATAGGAAGTTTATTAAGGACTTTGCGAAGTTGACGAAACCTTTAACAGCATGTCTAAAAAAGAACGCAAAGGTTGAACATACAAACGAATTTTTAGACGCAGTTGATAAATGCAAACAAATTCTAACAAACGCCCCAATCCTGCAATACCCTGACTTCGACAAACCGTTTATTTTAACGACAGACGCATCTGACTTTGCTTTAGGAGCAGTACTTTCCCAAGGCAATGTGGGCTCAGATAAACCAGTAGCCTATGCCTCAAGGACATTATCAGATACTGAGATCCGTTACTCTACCATAGAGAAAGAACTGTTAGGGATAGTATGGGCAATTAAGTATTTTAGACCTTACTTATATGGCCGTAAATTTACAATTTATACGGACCATAGACCCCTTACATGGTTAATGAGTCTAAAGGACCCTAACTCTAAATTAACACGATGGAAACTAAAGTTAGCAGAGTATGATTACAAAGTTGTTTATAAAAAGGGCAAACAAAACACTAACGCAGATGCACTATCCCGAGCAAAAATTTTTCATAATAGTATAGATTCTCTAGCTGTTAATGTTGATGACAATAGTGACGACAACATAATAAATAGAATATTCGAAAACGCCCGTAGACAGGCAGAGATAGAAACTAATGACCCGAATAACCAAGACAATGAACGTAACAATACTGACAATAACGACCAACCTTATAACAACAATGACGTAGAAATGACCAGTATCTATCCCTCTCAAATTGACGAAGAGACAGACACAAGGAGTGCAACAACAGTCGACCCCGATCAATTAGTTTCTACAAATCATACCCAACCTGATAATGAAAATAACGGTATCCCTATAATATCCGACGCTATTGATAGACAGTTGAAACAATTTTACGTTAGGTCCACACCAGGTTCTACATACAGAGTAGAGGACAGATCAACAAACTCTAGGACAGTTATTAAGGATGTTTTCATCCCAGTAAATAACACTGAATCAGAAATTATCAAATTTTTAAAAGAACACACAATAGCTGACCGTGTTTTTCATTGCTATTTTTACGACGAAAATCTATACTTAGCCTTTTCAAGAGTGTATACTACGATATTTAATGACAGAGGACCTAAATTAATAAGATGTACTTCGCGGGTCACACTTGTTGAAAATAAAACTGAACAACAAGAACTCATTAAGCGATATCACGAAGGTAAATCATCGCATCGCGGTATCCAAGAGACCTTTAAGCATCTGCATAGGAATTATCACTGGCCTAATATGTTATTGACAGTTCAAAGGTTCATTAATCAATGCGACCTTTGCCTAAAGGCCAAATATGAAAGAAATCCTTTAAAACCTCCATTGATTATAACAGAGACACCTACGAAGCCATTTCAACACTTGTTCATGGATCTCTATAGTACTGGAGGTGCAACATTTTTAACAATTATCGACAATTTCTCTAAATTTGCCCAGGCGGTGCCTCTGAATGCTTCTAGTAGTGTTCACATCGCAGAAGCTCTATTACAAGTATTTTCTGTACTAGGACTACCTCTTAAAATCACCACAGACTCAGATACAAAGTTCGATAATGACGTCATAAAAGAGATATGTGCTTCGCATGATATCCACATTCACTTCACGACGCCTTACAACCCAAACTCTAACTCACCCATTGAACGATTTCATTCAACCATCGCAGAAATAATAAGAATTCAAAGAATGACAAATAAAGACGACCCCATACAATTGATCATGAAATACGCTATAATCGCCTATAACAACGCTATTCATTCTACTACAGGCTATACACCACGTGAGCTTTTATTCGGTCATACGGCATCCCGAAATCCATTAGAGCTATATTATCCTAAAGAATTTTATCAAGATTATGTCCTCAATCACCGCAAGAATGCAGAAGCAGTACAGGAATGTATAGCAGCCCACGTGTCTAAGAACAAAGAGCAGGTAATAGAAAAGAGAAACCAGGCAGCGCAAACAATCACGTTTAAGACCACATCTTGTTCCAGGACCCTCATCGCAGGAGCCTTCGTGCTCTACACAGCCGCCGACTTGACCCTTAATCCTATAGACAATAGTAATGGCATCCTTTTGTTAAAACAAGGACAAATTTTGAAGCAGATAGACACTTTTAGTCTGGCCTGCGTATATAACGTATCGTATTTACATGAAACAACCTTAAAGCTTATGTCTTTATATGCCAGTACTAAAGCTGCTGAAGGTAACGAAGAGTTGCATAGAGCATATAAGGATCAAATAGAAAATAGTTTACATTTAATAGGGAAGAAGTTAGCATTTATTGCACCGCACCATAGATTTAGACGTGGCTTAATTAACGGTTTAGGTTCAGTAGTTAAAACTATTACAGGTAATCTGGATTATGAAGACGCTATTAAGTTTGAAAATGAATTATCTAATCTACGTAATTCAGTCCATAATATTAACACATCTCAAAAACAAACTTTATTCATAGCAAAGCACGCAGTTGAAGAATTTAGTAAACAGATCAAGTTATTAGACGAAAATCAGAAAAAGATAGGTTCAATGTTAAAAAACGCCACTTTAAGTAATAACGTAGTAATAAGCAGATTGCACTTTTTAGATTTATATATCCAAATATATTTTAGTTTGCAATTACTCTTAGATAAATTAGTTATATTAGAAGACGCCATGACCTTTGCACAACTAGAAGTAATGCATCCTAGCATTATAGCTCCACACAGTCTTATAAGTGAAATAACAGCTATTCAAAAACTTTACCAATTTAGACCCGTTGATAGAATAAGTATTAAAAATATTCATAGTATAGAGAGCTCTATTAGCGTAAAAGCGTATAGCACAAACGACGCACTAACATTCATACTAGATATCCCTTCCATAGATGAAAACCTTTATGACCTTATCCATCTATACTCCATACCAGATAAACAAAACCTCACCATTATTCCTAAATCCAAATACCTAGCACTGGGAACCAACGAGTACTCATACCTGGAGGAAGATTGCAAAAAGATCACACAAGACGTCCAACTCTGCACATCGCTGAACACCCAACCTGTGGAGAACTCTGAAGACTGCATAGTAACTCTTATAAAACACGAGAGCACAAACTGCACCCGTGCCAGGATGAACCTGAAACAAGGCAAGATCCAGAGACTAGAAGACAACAAATGGCTTATCATCTTGAAAGACGAACAAATCCTGAAATCTCGCTGCGGAAGGAAATCTGACTATAAAAAGATGTCAGGAATATACATCGCCAGCATTACAAGCGATTGTCAAGTGGAAATATTCAACCGAACACTGAAGACAAACACGGACACTATTACAGCTGATGAAATCGTACCCATTCCCAGCGAAACCACTATTCTAGAAGGGAATATTCGCTATAACCTACAACTGAAAGATATATCTCTGGATAGCATCCACGAACTGATGGACCGGGTTGAAAACATTCAACAACCTGTCATCGACTGGCAGACTATGATGACTACCCCAAGTTGGTCAACACTGGGACTCTACCTCATTCTGATAGCAATAATCATCTGGAAGCTGTGGCAGTGGAGACAGCGACGACTACAATCAAAGAACGAGAGCCCCGAGAACACTAGCATCGAGGACGCTGCTGGAAGCTGCGGGACGCGCTTCTATCTTAAGGAGGGAGGATCACAATGCTCGTCCCAGGAGCGGTTGCTGGCCGTGCAGACGGCCTGCGACCCGCAGCCCCGGGCGCCGTGTCCTCATTGCCAACATCAGAACTCGCTCAACAGTTCACAGGGCAGCGGTATGAACAACTGGGCGTCCCTTTCGGATAGCGGCGGCAGTGGCAATGCTGGAGCCCGCGCGCCCTCACCGCAGGGCTTGTCGCGACGGGTCCGGAGTCGCAGTCTCAGTCCTTCCCGTTCTATCGGCGGCTCGTCGGGCGGGGGGTCCGGCTCGCGGGACGACGCCGTGTCGGCCATGTCGTCCCTGTTCGCTGCCAGATTCCCCGCCGCTCAGAAATCTATGGACGACAAATTAAGAGGACTCATTGATGAGCTCACGGAATTGGATAAGAAACCTGATCGGCCGCCTATAGAGAGATTCGTACAGAGACAGGTTCTGGAGATGGCTCGCGACTGCCTCCACAAGTCTGAATCAAAGCAGGTGACCAGCACCTACTTCTACGACATGGCGGACAGTCTGGACCGGCTACTTGCAGAGACGAGAGAGAAGTCAGCCGAAGCGGGTGGTCAGGTGGCGCCGCTGGTCAACCGGCTGATCCTGGCGATGGCCCGGCCGGCGCGCCTGCTCGAATGTCTGGAGTTCGATCCCGAGCGGTTCTACAGGCTGCTGGAGGCCGCGGAGGGACACGCCCGACATTTGCAGGGCATAACAGACATTCCACAGTACATCATCCACAAGCTGGGACTCTCCAAGGACCCGCTGGCCGAGCTGCACGCCCCCCCGCCCCCTCCCCTCCCGCAGAATACCTCGCCTTCCAAGCTTCGCGGCCGCCAGTCGCCCCCCGGCTCGAGTTCGGGGGCGCCTCCCTCGGAAGCTGACTACCAGGTCATAAAGCTCATATCGAACGGAGCTTACGGAGCCGTGTATCTAGTCAAACACAAACAAACGAGACAGAGGTTCGCCATGAAGAAGATCAGCAAAAACAACTTGATACTGAGGAACCAAGTGGAGCAGGCGTTCGCCGAGAGGGACATCCTCAGTTTCGCTGATAATCCGTTCGTGGTGACGATGTACTGCTCGTTCGAGAGCCGGCGGCACCTGTGCCTCATCCTGGAGTTCGTGGAGGGCGGCGACTGCGCCACGCTGCTGCGCGCCGGCCCGCTGCCGCCCGACATGGCGCGCCACTACTTCGCCGAGGCCGTGCTGGCCGTCGAGTACCTGCACTCCTACGGCATCGTGCACCGCGACCTCAAGCCCGACAACTTGCTGATCACGGCCACCGGCCACATCAAACTGACAGACTTCGGGCTGAGCAAAATGGGACTTATGTCGTTGGCGACGAATTTATACGAGGAGTACGCCGACAGAGAGGCGCGGCAGTTCTCCGACAAGCAGGTCTGCGGCACTCCCGAGTACATCGCGCCGGAGGTCATACTCCGACAGGGCTACGGGAAGCCGGTGGACTGGTGGTCGATGGGAGTCATTCTGTACGAGTTCCTGGTGGGATGTGTGCCGTTCTTCGGCGACACCCCCGAGGAGCTGTTCGCTCATACCGTCAATGATGACATAGAGTGGCCGTCGGAAGAAGACTTTCCGATTGCGGTGGAAGCCAGAGCCATCATCACGGAACTCCTCGCGCGCAACCCGAGGGACCGGCTCGGGACTGGCGGCACCCATCAAGTCAAGGACCACGTTTATTTCTACGGCCTGGACTGGAACAACCTGCTCAGGAGGAAGGCCGAGTTCATACCGCAGCTGGAGAACGACGAAGACACCAGCTACTTTGATAGTCGGTGCGAGAGGTACAACCACAGCGAGGTGGACACGGACGAGGCGGCCGACGCGCCCGACGACGGAGTGTTCGCCGCCTTCTCCAGCACCTCGCCGCAGTGGAGGAGGCACCATCACTCCTGCGCCGAGCACGACTCCCGGAGCACGGACAGCTGGCCTGGCACACCGGACAGCGCCGGGCCGCCCACGACGCCCACAGCGCCTCTGCATCATCATCATCCGAAATGTCCTGTGGTGGGCAGCAGCCAGCAGGTGTCGGCGGAGTCGTCGCAGACGGACAGCGAGGACGTGTCGCCGGCCGCCCGCCGCCGCGCCCCGCCCCGCCTGCACCTGCCCTCCGCGCTCGCCCTCACCCCCCGACTTTCGGACATCCGAAGAGAGGACCGAAGCATAGACAAGCCGGATAGAACGGAGAAGACGAAGCCGACAGCCATTATGGCGGCAAAATCTATGCGGCGTTCGGCCAGCACTTCAGGATTGTCTTTGGTTATACATCCAGCCGACGACAGCACGCTGAGCGCGGGGGCGGGCTCGCCGTGCGCCGGCAACACTTCCTCCACCAACTCCTCGAGGGACTCCTCGCCGTGCAGAGATCCGCCTTCGCCGTTCGCTTTGCCGAATCATTCTTTGATCCAAGCGTCGAAGCCGCCGATGGTTGTGCGGCGCGGCCCCCGCGGGTTCGGCTTCACGATCCACACGGTCCGCGTGTACTACGGCGACACGGACTACTACACTATGCACCATCTCGTCTCGGCCGTGAACGAGCAAGGCGCGGCGTGGGCAGCCGGTTTGAGAGCCGGCGACCTCATAACGCAGCTGAACGGCGAGTCAGTGCAAGGGCTGCTGCACACGCAGGTGTTAAGGTTGCTATTGGCAGCGCCGCACGCGACGTTACGAGCGACACCACTGGATCAGACAACTATACAGTCTGGTGGGCGTCGCCGTACTAGCGGCGGGAGGAGGGCGTATGCCCCCCCTCGACCGCGGCCCCGCAGACGATGCTCCCTGTTTAGAAGGATATCCACCAAACGCGCTACACAGGAAATGCATCAGATGGTATCGGGCGAGGCGGTGACGTCAGCGCCCCCCGCCGCGCCCCCCGCGCCCCCCGACGCGCCGCTGCACGCCAACACGCACTTCCAGAGACCGTCGTCGTTACACGGGCTGAAGCACAAGCTGGTGGGCGGCGCGGAGGTCCGTCGCTCTTCGCTGCAACACATGCCGCTGTCCCCCCTCGCGAGGACGCCCTCCCCCTCGCCGCAACCCCCGCCCCCTGCCTCGCCTACCAGTCGCGTGGAGGCCCGCAGTCCTTCGCCGCTCGCGACGCGGGAGTGCGGGCGCCGCGCCTGGCCGAGACGCGACCCCGCCTCCCCCCTCCTCCGCCGGGCGCTCTCGCCCGATAGATTACACCCTCGTTCAGCTGAAGCCAAGTGTTCGATATCGCCTCTGTGCTGCGGGGGGGTGGTGGCGGGCGTGTCGGTGAGCGCGGGGAGCACGCGGCGCGGCGGGGTGTGGCGAGCGCCCGCCCCCGCGCCTCCCACTCCGCCCCCCCAGGACAAGCCCGACGAGCCACCCCTGCCCAGGATAGCAGAGGAGAAGGATTCGCCGACGCATCACGCCAGAAACTTGCCTAATAGCCCGGCGAGACAGGCGACCCCCAGCATCTTCACGTCATCTCCGAAGACGAGTCTCGGCAAGTCTCCGTTCGACGCGTCCGCCTCATTCGCGTCGCTCTCACTCTCCGACGAGTCCTACATCGCGGATTCGTCCGTCAATCTATCCGTCTTGGATACGTCCAGGGACCTCTTTATCGACGAGTCCAGGACGAGCACGGAGCCGAGCGTCGCCGACGAGAAACCACCAAAAGTAGAACCTCCAGTTATCGAGCAGCCCAAAGTTCGGAAGAAGTCTGACTCGAGTCTTAAGGAGGAAGAGTTTAAAACGAAAAACAAAAAAACGGAACTCAAGAAACAAGATTCCTTGAAGAAGATCGAAGTCAAGGATGAACCCAAAGTGGAAGAGAAAAAAGTTGACAAGCCAATGGAACGAGTCGGCTCGGTAAAGAAGGTCGAGAAGGATATGAAGAAGGCGGAGAAGGCGGAGAAGAAACAGGATAAACAAGAGCCTAAGAGGACAGAGTCCCTGAAGAAGATGGAAGGACTGAAGAGACAGGAATCTGTCGAACTAAATAAGTCTCCAGAAGCGGTCGAGAGCACGGAAGCTCGCAGCAAAAGCGTCGTCAGTAAGCTGCTGGGCGTGATGGGGCGGCGCTCCACTAAGGACCGGGACGACGACGAGCATCGCCTCTCCAAGAAGCACGATAAGCACGCCAAAAGAAAGGGCGGCAGTACGCCGGGCCAGCCCAGGCCGCCGGAGCCGGTGCCGCCGACGGAAAGGGAACCAGAGGACAAGAAACGCAAGAACCGCGGCCGCGCCTCCAGCTCCTCGTCAGGAGAGAAATAG
Protein
MLALSPLPSHLVENSQKYEINKIETETDIDKELCENLKKIRTSHMNEEEKREITKICYQYRDIFYSENIPLSFTHTVKHELRLTDDTPIFVRSYRQAPQQRTEIQKQVDSLLKQGIIRESISPWSCPVHIVPKKPDASGKVKWRLVIDYRRLNDRIIEDKYPLPNINDILDRLGRAQYFTTIDLASGYHQLEMHPKDVEKTAFTTERGHYEFLRMPFGLKNAPSTFQRLMDHILRGIDNVFTYLDDVIIAATSLQNHNEKLKLVFQRFKMHNLKVQLDKSEFLQKHVNFLGHELTDQGLNPNKDKIKAVLNFPIPQTQKDIKAFLGLVGYYRKFIKDFAKLTKPLTACLKKNAKVEHTNEFLDAVDKCKQILTNAPILQYPDFDKPFILTTDASDFALGAVLSQGNVGSDKPVAYASRTLSDTEIRYSTIEKELLGIVWAIKYFRPYLYGRKFTIYTDHRPLTWLMSLKDPNSKLTRWKLKLAEYDYKVVYKKGKQNTNADALSRAKIFHNSIDSLAVNVDDNSDDNIINRIFENARRQAEIETNDPNNQDNERNNTDNNDQPYNNNDVEMTSIYPSQIDEETDTRSATTVDPDQLVSTNHTQPDNENNGIPIISDAIDRQLKQFYVRSTPGSTYRVEDRSTNSRTVIKDVFIPVNNTESEIIKFLKEHTIADRVFHCYFYDENLYLAFSRVYTTIFNDRGPKLIRCTSRVTLVENKTEQQELIKRYHEGKSSHRGIQETFKHLHRNYHWPNMLLTVQRFINQCDLCLKAKYERNPLKPPLIITETPTKPFQHLFMDLYSTGGATFLTIIDNFSKFAQAVPLNASSSVHIAEALLQVFSVLGLPLKITTDSDTKFDNDVIKEICASHDIHIHFTTPYNPNSNSPIERFHSTIAEIIRIQRMTNKDDPIQLIMKYAIIAYNNAIHSTTGYTPRELLFGHTASRNPLELYYPKEFYQDYVLNHRKNAEAVQECIAAHVSKNKEQVIEKRNQAAQTITFKTTSCSRTLIAGAFVLYTAADLTLNPIDNSNGILLLKQGQILKQIDTFSLACVYNVSYLHETTLKLMSLYASTKAAEGNEELHRAYKDQIENSLHLIGKKLAFIAPHHRFRRGLINGLGSVVKTITGNLDYEDAIKFENELSNLRNSVHNINTSQKQTLFIAKHAVEEFSKQIKLLDENQKKIGSMLKNATLSNNVVISRLHFLDLYIQIYFSLQLLLDKLVILEDAMTFAQLEVMHPSIIAPHSLISEITAIQKLYQFRPVDRISIKNIHSIESSISVKAYSTNDALTFILDIPSIDENLYDLIHLYSIPDKQNLTIIPKSKYLALGTNEYSYLEEDCKKITQDVQLCTSLNTQPVENSEDCIVTLIKHESTNCTRARMNLKQGKIQRLEDNKWLIILKDEQILKSRCGRKSDYKKMSGIYIASITSDCQVEIFNRTLKTNTDTITADEIVPIPSETTILEGNIRYNLQLKDISLDSIHELMDRVENIQQPVIDWQTMMTTPSWSTLGLYLILIAIIIWKLWQWRQRRLQSKNESPENTSIEDAAGSCGTRFYLKEGGSQCSSQERLLAVQTACDPQPRAPCPHCQHQNSLNSSQGSGMNNWASLSDSGGSGNAGARAPSPQGLSRRVRSRSLSPSRSIGGSSGGGSGSRDDAVSAMSSLFAARFPAAQKSMDDKLRGLIDELTELDKKPDRPPIERFVQRQVLEMARDCLHKSESKQVTSTYFYDMADSLDRLLAETREKSAEAGGQVAPLVNRLILAMARPARLLECLEFDPERFYRLLEAAEGHARHLQGITDIPQYIIHKLGLSKDPLAELHAPPPPPLPQNTSPSKLRGRQSPPGSSSGAPPSEADYQVIKLISNGAYGAVYLVKHKQTRQRFAMKKISKNNLILRNQVEQAFAERDILSFADNPFVVTMYCSFESRRHLCLILEFVEGGDCATLLRAGPLPPDMARHYFAEAVLAVEYLHSYGIVHRDLKPDNLLITATGHIKLTDFGLSKMGLMSLATNLYEEYADREARQFSDKQVCGTPEYIAPEVILRQGYGKPVDWWSMGVILYEFLVGCVPFFGDTPEELFAHTVNDDIEWPSEEDFPIAVEARAIITELLARNPRDRLGTGGTHQVKDHVYFYGLDWNNLLRRKAEFIPQLENDEDTSYFDSRCERYNHSEVDTDEAADAPDDGVFAAFSSTSPQWRRHHHSCAEHDSRSTDSWPGTPDSAGPPTTPTAPLHHHHPKCPVVGSSQQVSAESSQTDSEDVSPAARRRAPPRLHLPSALALTPRLSDIRREDRSIDKPDRTEKTKPTAIMAAKSMRRSASTSGLSLVIHPADDSTLSAGAGSPCAGNTSSTNSSRDSSPCRDPPSPFALPNHSLIQASKPPMVVRRGPRGFGFTIHTVRVYYGDTDYYTMHHLVSAVNEQGAAWAAGLRAGDLITQLNGESVQGLLHTQVLRLLLAAPHATLRATPLDQTTIQSGGRRRTSGGRRAYAPPRPRPRRRCSLFRRISTKRATQEMHQMVSGEAVTSAPPAAPPAPPDAPLHANTHFQRPSSLHGLKHKLVGGAEVRRSSLQHMPLSPLARTPSPSPQPPPPASPTSRVEARSPSPLATRECGRRAWPRRDPASPLLRRALSPDRLHPRSAEAKCSISPLCCGGVVAGVSVSAGSTRRGGVWRAPAPAPPTPPPQDKPDEPPLPRIAEEKDSPTHHARNLPNSPARQATPSIFTSSPKTSLGKSPFDASASFASLSLSDESYIADSSVNLSVLDTSRDLFIDESRTSTEPSVADEKPPKVEPPVIEQPKVRKKSDSSLKEEEFKTKNKKTELKKQDSLKKIEVKDEPKVEEKKVDKPMERVGSVKKVEKDMKKAEKAEKKQDKQEPKRTESLKKMEGLKRQESVELNKSPEAVESTEARSKSVVSKLLGVMGRRSTKDRDDDEHRLSKKHDKHAKRKGGSTPGQPRPPEPVPPTEREPEDKKRKNRGRASSSSSGEK

Summary

Uniprot
ProteinModelPortal
PDB
4OL8     E-value=5.16951e-78,     Score=749

Ontologies

Topology

Length:
2972
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.87823
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  2972
 
 

Population Genetic Test Statistics

Pi
210.34512
Theta
154.82125
Tajima's D
1.192773
CLR
0.423489
CSRT
0.708764561771911
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号