SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15901
Pre Gene Modal
BGIBMGA013403
Annotation
PREDICTED:_muscle_calcium_channel_subunit_alpha-1-like_isoform_X3_[Bombyx_mori]
Full name
Voltage-dependent L-type calcium channel subunit alpha       + More
Voltage-dependent calcium channel type D subunit alpha-1      
Muscle calcium channel subunit alpha-1      
Alternative Name
MDL-alpha-1
Location in the cell
PlasmaMembrane   Reliability : 4.375
 

Sequence

CDS
ATGGCATCGATAGAGCAAACCCCGACGGTGGCTACGACCCCGTACATGGAGAACGTCACTGACCCGACACTGGCAGCAGCCGCCGCCGCGAAGAAACAGGCTCGGGGCAGAGGAAAAGCGCAACCAGAAAAACCTAAGAGGAGCTTGATGTGCCTCACTCTGGACAACCCTTTACGGAAACTATGTTATAGCATCGTTGAGTGGAAACCATTTGAATACATGATCTTGACCACGATCTTCGCAAATTGCATCGCCTTAGCGGTATTCACACCGTACCCGTTCGGAGATACGAACAACACAAATCAAATACTGGAAAAAGTGGAATGGGTTTTCATGGTGATATTCACCGGGGAGTGCATCATCAAGATCATAGCGTACGGCTTCTTTTTTCATCCAGGAGCCTATCTTCGGAATACTTGGAACAGTCTAGATTTTACTATAGTCACAATCGGTATTGCGAGTATGATACAACAGTACCTTTCGATAGATTTGTTCGACGTAAAAGCACTGAGAGCTTTCAGGGTACTGAGGCCCTTACGACTCGTTTCCGGAGTACCTAGTCTTCAAATAGTTCTGAATTCCATCCTGAAAGCCATGGTGCCGCTCTTTCACATAGCCTTCCTTGTGCTGTTCGTGATCATCATCTATGCCATCATAGGCTTGGAGCTGTTCTCGGGAGTGCTCCATGAAACTTGCTTCAACAATGAAACAGGTGAGACAATGGCGAACCCTGCGCCTTGTAGTAGCACTCAAGGCGATGGTATGAAGTGCAAAGACAATATGACTTGCAAGGGTTATTGGGATGGACCCAATGATGGGATCACCAATTTTGACAACATCGGATACGCCATGTTGACTGTCTTCCAATGTATCACGCTTGAAGGCTGGACAGATATTATGTATGCGGTGGCCAACGTCAAAGGCAAAACGTGGGTTTGGATCTACTTCGTGACTTTGGTGATCTTCGGGAACTTCTTCGTCATGAATCTGATCCTGGGTGTGTTGTCAGGTGAGTTTTCCAAAGAAAGAGAGAAAGCGAAGAGCCGTGGCGATTTCCAGAAGTCACGCGAAAGGCAACAGCTGGAAGAAGACATGAAGGGGTATCTGAATTGGATCACAGTTGCGGAAGAGCTGGACTTGGAGAATGAACAGACGCAGAATGAAGATGATCAGGACGCCCAGGGCAAGAAAGATAGAAAGAGCAATGAAGAATCACAGAATAATTTGAATGTGAACGGGGATCAAGTACAAACATCAAGATCCTATAGATTCGATAAGGTCAATCGTCGATTACGTAGAGCCTGCAGAATAGCCGTGAAGACACAGACTTTCTATTGGGCAATCATCATATTGGTATTCCTCAATACGCTGGTGCTAGCTACTGAACATTACAATCAACCTCGATGGCTTGATTATTTCCAGAACTACGCCAACTATTTTTTCGTTGTTCTGTTCACCCTTGAGATGATGCTGAAGATGTACGCGCTAGGATTTCAGGGCTACTTCGTATCCCTATTCAATCGCTTCGATTGCTTCATCATGGTCTGCTCTGTGGTGGAATTGGCGCTTACTTTAACAGAGACCATACCGCAGCTCGGTATCTCCGTGCTGAGGTGTGTCAGGCTACTAAGAGTCTTCAAGGTTACCAAGTATTGGCGGTCTCTTTCTAATCTCGTAGCATCTCTGCTTAACTCCATCCAGTCCATCTTCTCCCTTCTTCTGCTGCTATTCTTGTTTATCGTGATCTTCGCTTTACTTGGGATGCAAGTGTTTGGTGGGAGATTCGACTACGCGCCGGAAGCTGAGAAAGAGAGGCATAACTTCGATTCTTTCTGGCAGGCAGTTCTGACCATGTTTCAGATACTGACAGGCGAAGATTGGAATGTAGTCATGTATGAGGGGATCAAGGCATACGGAGGCGCCGGGACTCCGGGCATGCTGGCGTCTATATACTTCATCGTTATATTCATTTGCGGCAATTATATTTTACTAAACGTATTCTTGGCCATCGCTGTCGACAACCTCGGCGACGCAGAGGAAATGGATGCAATCGAAAAACAGAAAGAGATGGCAGAAAACGCTGAAGCCGGTAATGTGGTTCTCGATGAAGAAAGAGGAGAAACTGATGATGAATATGTTAACGAGGAAGAAGGATATTCTAATGAAGGATCTGAGAATGAATGTGAAGAGACCGGTTCTGAAGAAGACGTGGAAGAACAGGAACAAGAGGAGAAAGAGAATCCTCAAGATATATTGGTCACTATTGACAAAAAACAAAATGGAGACGTTAACAAAAAAGAATCAGAGCCCCATGTAACAATTTCGGCCCGACCTCGAAGGTTATCGGATGTGAACATCAAAACGCAAGAGAAGCCTATACCTGATGCCAGTAGCTTCTTTATACTCTCCAAGGATAATTGTTTTCGGGTGGCCTGCTACAATATTCAAAAAAATTCCTGGTTCAAGAATCTTATTCTGATATGCATCTTGGCGTCTTCCGTCATGCTGGCTTTGGAGGACCCTGTTACCAGCAACTTGAACACCCCTACTGGGATAAATGAGGTTCTACGCAACGTGGATTACTTCTTCACGGCTGTTTTTACAATTGAGCTGCTATTGAAGCTCATTACATACGGTTTTATACTGCACAAAGATTCTTTCTGTCGTTCTGGATTCAACTTGCTCGATTTGCTGGTTGTGATCGTGTCTTTTATATCGTTGGACAGATCAAACAGCGTCAACTTCATTAAGATTTTGAGGGTCTTCCGCGTTTTAAGGCCGCTTCGTGCCATAAACAGAGCCAAAGGTCTGAAGCACGTAGTTCAATGCGTGATCGTTGCTATAAAGACAATCGGAAACATATTATTGGTGACAAATCTTCTACAATTCATGTTTGCCGTTATGGGAGTGCAAATGTTCAAGGGTAGATTTTTTAAATGTACAGATATTACGAAGGACAATGAAAATGATTGCCATGGCACGTATCTCATTTACGAGAACGGCGAGGCCATAACGAACGATCGTTTGTGGCTGCGCAACAAATTCAACTTCGACGACGTCCTCAACGGTATGCTGACTCTTTTCACCGTCTCCACGTACGAGGGATGGCCGGCTCTGCTCTCCACATCAATGGATTCTAATAAAGAGAATCACGGACCTATAGAAAATTCAAGGCCGTTCGTCGCGTTCTTCTATATCAGCTACATCATTGTCATTGCCTTTTTTATGGTCAATATCTTCGTGGGCTTTGTCATAGTCACGTTCCAGAAAGAAGGAGAGCAAGAGTTCAAGGACTGCGAGCTGGATAAGAACCAGAGGAACTGTATAGAGTTCGCACTAAAAGCCAAACCGATCAGAAGATACATTCCAAAGCATCGCATCCAGTACAAGACTTGGTGGTTTGTGACCTCGCAGCGTTTTGAAAACGTCATCTTTTTCTTCATCGTGCTAAACACCATCGCGCTGATGATGAAGTTCCATGGCTCCAAAACGGAATATAAAAAGGGACTTGACGTTCTTAATATGGGATTAACCACTGTCTTTACTTTGGAGTTCATCCTGAAATTGGCCGCATTTAGGTTTAAGAACTACTTCGGCGATGCTTGGAATACGACGGATTTCATTCTAGTCGTGGGGAGTATCATTGACATACTGGTGACGCAGGTCAACGAAAAAAAGGAGCTCGGAAGTTTCGATGCAAAAACTGAGAAAGGTCCCCTGTCAAAATACATTACGTTCTTTCGTCTCTTCCGGGCCATGAGGTTGATAAAACTCTTATCCAGAGGAGAGAGGATCAGGACTCTCCTGTGGACCTTCATCAAGTCATTCCAGGCTCTACCTTATGTCGCTTTATTGATTGTACTGCTATTCTTCATTTACGCTGTGGTTGGAATGCAGCTTTTCGGAAGAATTTACTTTGACGACGCAGTCATAACTGACCATAATAATTTCCAGACATTTCCGAACGCTCTCATGGTGCTCTTTCGGTCTGCCACAGGTGAAGCATGGCAGGAGATCATGATGGCACTGTCGCCCAATGAATACGAGCGTCCAGGTAATCCGCCTCACTGCATCAAAATCGACACAGACGGCCGCTACGTTGAAGATACAACAGAATGCGGTAGTTGGCTAGCGTTCCCCTACTTCATATCCTTCTCTTTGCTCTGTACATTCTTGATCATTAACTTATTTGTGGCGGTCATCATGGACAACTTTGATTATTTGACGAGAGATTGGTCCATTCTTGGCCCCCATCATCTGGACGAGTTTGTTCGGTTGTGGAGTGAATACGACCCCGACGCTAAAGGCAGGATCAAGCACTTAGACGTGGTGACGTTGCTGAGGAAAATAAGCCCGCCTTTAGGTTTCGGAAAGTTGTGCCCTCACAGGACTGCGTGCAAGCGTCTGGTGTCGATGAACATGCCTCTCAATTCCGACGGGACGGTCAATTTCAACGCGACCCTCTTTGCTGTTGTCCGAACTCAACTCCAAATAAAGACTACAGGTGTAATTGACGAATGCAATACCCAACTCCGCGCGATCATCAAAAGAGTTTGGAAGAGAACTTCTCCCAAGCTCCTGGACCAAGTGGTCCCGCCTCCCGGAGACCCGAACGAGATCACGGTGGGAAAATTCTACGCGACTTTCCTAATTCAAGATTACTTCCGGAGGTTCCGAAAACGAAAGGAGCAGGCTGCAGCCACCAACGTCCAGAAAACCTTCCAGGCTGGTATGAGGACTCTACACGAAGCCGGTCCAGAGCTGAAGAGAGCTATCTCCGGTAACCTAGATGAGATCGTCGAAATTGTGGAGCCTATGCACAGGCGCAACCACACATTATTCGGTGCTGTCCTAGCAAGTATCAAGAAACACGGTCGCGAGAGCTTGTATAGAAGAGAAAAACCACGTCAAGAAGTAAAAAGCTCTGCATCTGGCGATGGACCATCACTGGGCGCCATGATGCGACGGGAGCTTGGCTTGGATGGCAAAATACCTGAGGAAGAAGTGAAAGGTGACGAAGGTAACCACAGCGACGAAGAGATAGCGATGCAGCCTCTCCTTCACGGCAAAGATTCGGAAAGCATTTTCAAAGTTATCGAAAAAACATCCAACGATTTATTGCAGAGTATGCGAAACAACCGTCGTGACAAACAACGTGTACAAACCAACCACGTGCCTTACTGTGTAGAGAATCCTGCGGAGAAATTAATAATAAGGGTGCTGACCGAGCAAGGTCTAGGGAAGTACTGCGACAAAGACTTCATCGAGACCACGCTAAGAGAGATGCGAGAGGCGCTGGACCTAACACCGAACGAGATGGACACTGCTGCCAACCAAATAATAATGCAAGAGAGGATAATGAACGAAGCACAGCATCGACCGAGCGATGTGGAGAGTATTTTGTCAAGGCAGTACCATCCCTTCCACCAGCCTCCGATGCAGCCCCCTCCTAGGAAGAAATAA
Protein
MASIEQTPTVATTPYMENVTDPTLAAAAAAKKQARGRGKAQPEKPKRSLMCLTLDNPLRKLCYSIVEWKPFEYMILTTIFANCIALAVFTPYPFGDTNNTNQILEKVEWVFMVIFTGECIIKIIAYGFFFHPGAYLRNTWNSLDFTIVTIGIASMIQQYLSIDLFDVKALRAFRVLRPLRLVSGVPSLQIVLNSILKAMVPLFHIAFLVLFVIIIYAIIGLELFSGVLHETCFNNETGETMANPAPCSSTQGDGMKCKDNMTCKGYWDGPNDGITNFDNIGYAMLTVFQCITLEGWTDIMYAVANVKGKTWVWIYFVTLVIFGNFFVMNLILGVLSGEFSKEREKAKSRGDFQKSRERQQLEEDMKGYLNWITVAEELDLENEQTQNEDDQDAQGKKDRKSNEESQNNLNVNGDQVQTSRSYRFDKVNRRLRRACRIAVKTQTFYWAIIILVFLNTLVLATEHYNQPRWLDYFQNYANYFFVVLFTLEMMLKMYALGFQGYFVSLFNRFDCFIMVCSVVELALTLTETIPQLGISVLRCVRLLRVFKVTKYWRSLSNLVASLLNSIQSIFSLLLLLFLFIVIFALLGMQVFGGRFDYAPEAEKERHNFDSFWQAVLTMFQILTGEDWNVVMYEGIKAYGGAGTPGMLASIYFIVIFICGNYILLNVFLAIAVDNLGDAEEMDAIEKQKEMAENAEAGNVVLDEERGETDDEYVNEEEGYSNEGSENECEETGSEEDVEEQEQEEKENPQDILVTIDKKQNGDVNKKESEPHVTISARPRRLSDVNIKTQEKPIPDASSFFILSKDNCFRVACYNIQKNSWFKNLILICILASSVMLALEDPVTSNLNTPTGINEVLRNVDYFFTAVFTIELLLKLITYGFILHKDSFCRSGFNLLDLLVVIVSFISLDRSNSVNFIKILRVFRVLRPLRAINRAKGLKHVVQCVIVAIKTIGNILLVTNLLQFMFAVMGVQMFKGRFFKCTDITKDNENDCHGTYLIYENGEAITNDRLWLRNKFNFDDVLNGMLTLFTVSTYEGWPALLSTSMDSNKENHGPIENSRPFVAFFYISYIIVIAFFMVNIFVGFVIVTFQKEGEQEFKDCELDKNQRNCIEFALKAKPIRRYIPKHRIQYKTWWFVTSQRFENVIFFFIVLNTIALMMKFHGSKTEYKKGLDVLNMGLTTVFTLEFILKLAAFRFKNYFGDAWNTTDFILVVGSIIDILVTQVNEKKELGSFDAKTEKGPLSKYITFFRLFRAMRLIKLLSRGERIRTLLWTFIKSFQALPYVALLIVLLFFIYAVVGMQLFGRIYFDDAVITDHNNFQTFPNALMVLFRSATGEAWQEIMMALSPNEYERPGNPPHCIKIDTDGRYVEDTTECGSWLAFPYFISFSLLCTFLIINLFVAVIMDNFDYLTRDWSILGPHHLDEFVRLWSEYDPDAKGRIKHLDVVTLLRKISPPLGFGKLCPHRTACKRLVSMNMPLNSDGTVNFNATLFAVVRTQLQIKTTGVIDECNTQLRAIIKRVWKRTSPKLLDQVVPPPGDPNEITVGKFYATFLIQDYFRRFRKRKEQAAATNVQKTFQAGMRTLHEAGPELKRAISGNLDEIVEIVEPMHRRNHTLFGAVLASIKKHGRESLYRREKPRQEVKSSASGDGPSLGAMMRRELGLDGKIPEEEVKGDEGNHSDEEIAMQPLLHGKDSESIFKVIEKTSNDLLQSMRNNRRDKQRVQTNHVPYCVENPAEKLIIRVLTEQGLGKYCDKDFIETTLREMREALDLTPNEMDTAANQIIMQERIMNEAQHRPSDVESILSRQYHPFHQPPMQPPPRKK

Summary

Description
Voltage-sensitive calcium channels (VSCC) mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, gene expression, cell motility, cell division and cell death.
Voltage-sensitive calcium channels (VSCC) mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, gene expression, cell motility, cell division and cell death. Encodes a dihydropyridine- and diltiazem-sensitive current in larval body wall muscle. Vital for embryonic development.
Voltage-sensitive calcium channels (VSCC) mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, gene expression, cell motility, cell division and cell death (By similarity). MDL-alpha1 encodes a dihydropyridine- and diltiazem-sensitive current in larval body wall muscle.
Similarity
Belongs to the calcium channel alpha-1 subunit (TC 1.A.1.11) family.
Keywords
Alternative splicing   Calcium   Calcium channel   Calcium transport   Complete proteome   Glycoprotein   Ion channel   Ion transport   Membrane   Metal-binding   Phosphoprotein   Reference proteome   Repeat   Transmembrane   Transmembrane helix   Transport   Voltage-gated channel  
Feature
chain  Voltage-dependent calcium channel type D subunit alpha-1
splice variant  In isoform B.
EMBL
ODYU01000836    SOQ36207.1    NWSH01001536    PCG70924.1    LADJ01044508    KPJ21426.1    + More
BABH01026241    BABH01026242    PCG70923.1    KQ459597    KPI95222.1    RSAL01000085    RVE48330.1    KPI95241.1    AGBW02010326    OWR48711.1    CM002910    KMY90461.1    U00690    AE014134    AY058268    GDHC01013994    JAQ04635.1    CM000157    KRJ98658.1    AGB93019.1    KRJ98662.1    EF595743    ABQ88369.1    ODYU01007597    SOQ50517.1    GEBQ01001497    JAT38480.1    CH963913    KRF98665.1    GEBQ01022182    JAT17795.1    GEBQ01030306    JAT09671.1    GEBQ01014334    JAT25643.1    UFQS01000565    UFQT01000565    SSX05001.1    SSX25363.1    GEBQ01004055    JAT35922.1    GAKP01019444    GAKP01019436    JAC39516.1    ATLV01020677    KE525304    KFB45536.1    OUUW01000006    SPP82466.1    KRJ98660.1    MF359245    AWK26948.1    GDUN01001113    JAN94806.1    CH477747    EAT36648.1    KMY90457.1    KMY90463.1    UFQT01000900    SSX27916.1    SSX04999.1    SSX25361.1    SSX27917.1    SSX27915.1    CH902620    EDV30642.2    SSX27913.1    Z31723    GBHO01030681    JAG12923.1    KQ971307    KYB29717.1    GBHO01030685    JAG12919.1    DS235844    EEB18335.1    CAQQ02090988    CAQQ02090989    CAQQ02090990    CAQQ02090991    GGMS01003201    MBY72404.1    GBHO01030682    JAG12922.1    GBHO01030683    JAG12921.1    MG973401    AWJ68254.1    KMY90462.1    JYDO01000127    KRZ69843.1    KRZ69841.1    ADMH02000580    ETN65778.1    LN609399    CEF60493.1    LIAE01008608    PAV73407.1    AADN05000356    AC171014    PAV73408.1    JYDH01000055    KRY35332.1    AXCM01000634    GDHF01017792    JAI34522.1    GECU01014145    JAS93561.1    GECU01002798    JAT04909.1    GECU01015631    JAS92075.1    GECU01008269    JAS99437.1   
Pfam
PF16905   GPHH        + More
PF00520   Ion_trans
PF08763   Ca_chan_IQ
PF16885   CAC1F_C
Interpro
IPR014873   VDCC_a1su_IQ        + More
IPR027359   Volt_channel_dom_sf       
IPR005821   Ion_trans_dom       
IPR031649   GPHH_dom       
IPR002077   VDCCAlpha1       
IPR005446   VDCC_L_a1su       
IPR031688   CAC1F_C       
IPR000731   SSD       
IPR029033   His_PPase_superfam       
IPR005452   LVDCC_a1dsu       
IPR005451   VDCC_L_a1csu       
SUPFAM
SSF53254   SSF53254       
Gene 3D
PDB
5GJW     E-value=0,     Score=2559

Ontologies

Topology

Subcellular location
Membrane  
Length:
1820
Number of predicted TMHs:
19
Exp number of AAs in TMHs:
425.9204
Exp number, first 60 AAs:
0.01478
Total prob of N-in:
0.55610
outside
1  -  72
TMhelix
73  -  95
inside
96  -  107
TMhelix
108  -  130
outside
131  -  144
TMhelix
145  -  167
inside
168  -  201
TMhelix
202  -  224
outside
225  -  310
TMhelix
311  -  333
inside
334  -  443
TMhelix
444  -  461
outside
462  -  475
TMhelix
476  -  498
inside
499  -  568
TMhelix
569  -  591
outside
592  -  649
TMhelix
650  -  672
inside
673  -  818
TMhelix
819  -  838
outside
839  -  860
TMhelix
861  -  883
inside
884  -  889
TMhelix
890  -  907
outside
908  -  944
TMhelix
945  -  967
inside
968  -  1019
TMhelix
1020  -  1042
outside
1043  -  1061
TMhelix
1062  -  1084
inside
1085  -  1139
TMhelix
1140  -  1157
outside
1158  -  1171
TMhelix
1172  -  1194
inside
1195  -  1278
TMhelix
1279  -  1301
outside
1302  -  1378
TMhelix
1379  -  1401
inside
1402  -  1820
 
 

Population Genetic Test Statistics

Pi
264.861805
Theta
158.097867
Tajima's D
0.520532
CLR
0.707547
CSRT
0.524423778811059
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号