SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15874
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.595
 

Sequence

CDS
ATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGTATATTAACGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATTAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCTCTCCCGACTAGGCGCGTCAACACCCCCGCCCCCGCCGTTCGCCCAATCACGATGTTCGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATTAAGACGGTACGCGATCGTGCCGCCTTCATCCTAGGACGTCTCTACCCGATGATATGTATGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCATACACTTAAAATCCTTTCAAATCATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCATCAGGAATGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTGCAGTCGGCGTCCATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTCCCGATACACTAACGGTGCTTTTAGGTACTTCAAGCACCGGTCACCGTTCTCGTCGAACCCGTCGCTTGCGACGAAGGGCTCGACGAGTAAATTAA
Protein
MGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNTPAPAVRPITMFDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICMRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARIHLKSFQIIQSRFCRIAVGAPWFIRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDTLTVLLGTSSTGHRSRRTRRLRRRARRVN

Summary

EMBL
KC165845    AFY12622.1    AB018558    BAA76304.1    U07847    AAA17752.1    + More
AB055391    BAB21761.1    KQ459580    KPI99178.1    KQ459259    KPJ02068.1    KQ459265    KPJ02064.1    AF081101    AAC72919.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    GALX01005300    JAB63166.1    GALX01005359    JAB63107.1    GALX01005299    JAB63167.1    KQ971729    KYB24751.1    GGMR01019198    MBY31817.1    GGMS01004685    MBY73888.1    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02014862    ABLF02014866    ABLF02061908    ABLF02042518    ABLF02057746    KQ973342    KXZ75569.1    ABLF02003961    ABLF02059872    GGMS01013269    MBY82472.1    ABLF02008933    GFTR01008038    JAW08388.1    KK113014    KFM59099.1    NEVH01026085    PNF14941.1    NEVH01012084    PNF30905.1    NEVH01000598    PNF43535.1    KB632361    ERL93526.1    GBBI01004571    JAC14141.1    ABLF02041993    ABLF02043973    GEBQ01017345    JAT22632.1    KK117880    KFM71667.1    ABLF02029215    NEVH01005938    PNF38077.1    NEVH01001355    PNF42855.1    APGK01020047    KB740155    ENN81216.1    NEVH01010546    PNF32261.1    GGMR01004707    MBY17326.1    NEVH01019964    PNF22161.1    NEVH01006754    PNF36554.1    NEVH01007838    PNF34986.1    NEVH01003017    PNF40781.1    NEVH01000280    PNF43672.1    ABLF02033757    NEVH01007443    PNF35684.1    NEVH01020071    PNF21969.1    NEVH01023962    PNF17612.1    NEVH01018383    PNF23463.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01014858    PNF27387.1    NEVH01011985    PNF31054.1    AF456125    AAL57609.1    NEVH01002716    PNF41415.1    NEVH01009134    PNF33528.1    GGMR01016114    MBY28733.1    NEVH01027074    PNF13841.1    AY180919    AAN87272.1    NEVH01026154    PNF14491.1    ABLF02019349    ABLF02041900    DNOY01000259    HBE18313.1    GFXV01006424    MBW18229.1    NEVH01023961    PNF17613.1    NEVH01017470    PNF24199.1    NEVH01019376    PNF22596.1    GGMR01018716    MBY31335.1    GBGD01000415    JAC88474.1    ABLF02022418    GGMR01000167    MBY12786.1    ABLF02066620    NEVH01006721    PNF37225.1    GEZM01039082    JAV81425.1    NEVH01026386    PNF14434.1    NEVH01016327    PNF25684.1    RPOV01000134    RPJ78669.1    NEVH01017559    PNF23833.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    GFXV01000774    MBW12579.1    NEVH01017542    PNF24034.1    NEVH01000269    PNF43694.1    S59870    AAB26437.2    NEVH01002704    PNF41489.1    GBGD01002174    JAC86715.1    ABLF02008463    KQ972067    KYB24656.1    GBYB01007412    JAG77179.1    NEVH01021205    PNF19912.1    GEDC01000118    JAS37180.1    ABLF02037436    GGMS01017421    MBY86624.1    KK116158    KFM66983.1    GEZM01038405    JAV81653.1    GGFJ01001858    MBW50999.1    GGMS01000737    MBY69940.1    GBBI01001692    JAC17020.1    NEVH01019080    PNF22876.1    NEVH01020963    PNF20308.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
PF10551   MULE
PF17919   RT_RNaseH_2
PF17921   Integrase_H2C2
PF00077   RVP
PF00665   rve
PF17917   RT_RNaseH
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR001969   Aspartic_peptidase_AS       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR001995   Peptidase_A2_cat       
IPR041373   RT_RNaseH       
IPR018061   Retropepsins       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
SSF50630   SSF50630       
Gene 3D

Ontologies

Topology

Length:
347
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.543689999999999
Exp number, first 60 AAs:
0.01605
Total prob of N-in:
0.02421
outside
1  -  347
 
 

Population Genetic Test Statistics

Pi
44.27273
Theta
51.002535
Tajima's D
0.580177
CLR
0.114985
CSRT
0.538873056347183
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号