SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15872
Pre Gene Modal
BGIBMGA013346
Annotation
PREDICTED:_muscle_calcium_channel_subunit_alpha-1-like_[Bombyx_mori]
Full name
Voltage-dependent L-type calcium channel subunit alpha       + More
Voltage-dependent calcium channel type D subunit alpha-1      
Muscle calcium channel subunit alpha-1      
Alternative Name
MDL-alpha-1
Location in the cell
PlasmaMembrane   Reliability : 4.391
 

Sequence

CDS
ATGAACGCGAACGGAGATTCTCAGGGCCTCGTGCCAGCTGCCCCCGCCACCACACCCACCGCCCCCCCCATCACCACACCGCCTGCTCATGTCGACGGCTCCTTACTTCCGATCCCACCAGTCGCCCCTAGGAAACCAGTCCGCAGGGGAGCCAAGGCACAACCAGAGAGGCCGAAGAGAGCACTCTTCTGCTTGACGATGAAAAATCCTCTCAGAAAAGTCTGCGTTGACATCGTGGAATGGAAACCCTTCGAGTGGATGATCCTAACGACAATATTCGCGAACTGTATCGCCTTGGCTGTCTACACGCCGTATCCTGCCAGCGACTCCAATTACACCAACTGGGTTCTGGAGAAAATTGAATACGTATTCCTTGTGATCTTCACCGGGGAATGCGTGATGAAGATCATCGCTTATGGCTTCGTGATGCATCCAGGGTCTTACCTTAGAAACGGATGGAATTTGCTCGACTTCACTATAGTGGTTATCGGAATGGTGAGCACAGTCCTGTCAAGCATCTTCAAGGACTCTTTCGATGTGAAAGCTCTACGAGCGTTCAGAGTACTTCGCCCACTCAGGCTGGTTTCTGGAGTACCGAGTCTGCAGATCGTGCTGAATTCTATCTTAAAAGCGATGGTCCCTCTCCTCCACATAGCTTTACTTGTGATATTCGTCATCATCATCTACGCCATCATCGGTCTCGAGCTGTTCTCCGGGAAGATGCACAAGAGCTGCTTCAATAAATACACAGATGAGATAATGGACAGTCCCCATCCGTGTGACAACGACAATGGCTTCAACTGCTCCTCCCTCGGCCCAGAGATGGAGTGTCGCGAGGGCTGGCCTGGCCCTAACTTTGGCATCACCAACTTTGATAATTTCGGTCTCTCCATGCTAACCGTCTTCCAATGCATCACGCTCGAAGGGTGGACCGATGTCATGTATAATATCCAAGACGCCATGGGTAACAGCTGGGAATGGATTTACTTCGTTTCGATGGTGATTCTGGGAGCTTTCTTCGTGATGAACCTGATTCTCGGTGTGTTGTCCGGTGAGTTCTCTAAAGAAAGAGAGAAAGCGAAGAACCGAGGTGACTTCCAGAAGTTAAGAGAAAAGCAGCAGTTAGAAGAAGATTTGAAAGGTTACCTAGATTGGATCACTCAAGCGGAATACTTGGAGCCCGTGGACCAACATGACAACAGCAATCAGAAAGGAGATTTCGGAGGACCGACACAGAACGAGCACGATTCCACGGATCATCTCGGCGTAGAAACAGTTGAACCACAGAAAGTGTCGATCTCATGGAAAAAGGATTTTGATAAGGTGAACCGCCGCATGAAAAGGGCCTGTCGAAAAGCGGTCAAATCGCAAACATTCTACTGGCTGATCATAGTTTTAGTCTTCCTGAACACGGTAGTGCTCGCCAGTGAACATTATCGGCAACCAGAGTGGCTGGACCATTTCCAAGAATACGGAAACGCGTTCTTCGTGGCTCTATTCACTTTAGAAATGTTAGTCAAAATGTACAGCCTGGGATTGCAAGGCTACTTCGTTTCACTATTCAACCGTTTCGACTGCTTCGTCGTGATCGGCTCCATCAGCGAGATGGTGCTGACGAAGAGCGAGGTGATGCCTCCACTGGGCATCTCCGTGCTGCGATGCGTCAGGCTGCTTCGAGTCTTCAAGGTTACGAAATATTGGCGTTCACTGTCCAACCTTGTAGCGTCACTCCTCAACTCGATCCAGTCAATCGCATCTCTACTTCTGTTACTGTTCCTGTTCATCATGATCTTTGCACTCCTCGGGATGCAAGTTTTTGGAGGGAAATTCAACTACGACCCTGTGGAAGAAAAGGACAGGCACAATTTCGATTGCTTCTGGCAGGCATTATTGACTGTTTTTCAGATCCTGACTGGTGAAGACTGGAACGCGGTTATGTATGAAGGTATCAAGGCATATGGAGGCGCAGGCACGGTCGGAATAGTAGCTTGTATATATTTCATCATATTGTTCATTTGCGGCAACTATATTCTTCTCAATGTGTTCTTGGCCATTGCTGTTGACAACTTGGCGGATGCTGAGTCGCTCACTAATATCGACAAGGAAGAGGGGGCTTGTGAAGAAAAGGAAGAGAGTATGGTAGCTATAGAAGGAGTTCAAGGTGATACTGATGATGAATACATACATGATGATGAAGCGTATACCACTGATAATTCTGAAAGGGAATATGAAGAAACAGGGTCAGAAGGTGACCCGCAAGATGAGATCGAAGAAGAAGAAGAAGAAGAATTAGATGAGAACGAGTTAGAAGATAGAGTCGAAGAGGAACAAGAAAGAGATGAAGATATGGAAATGATGGAAGGACACCAGCGGAATCATATAGATGGCGGCAAATCCGAAGAGGAGGGAAAACTGGTAACAGCAAGACCCCGACGCATATCAGAACTGAATATGCCAAATCAAACGCCGCCAATACCGAACGCTAGTAGTTTCTTCATATTTTCACCAACAAACAGGTTTCGAGTTCTGTGCTACAAATTGTCGTCTTCTTCGACATTTGGAAATATAATATTGGTCTGTATTATGCTTTCGTCGGCCATGTTGGCTGCTGAAGATCCATTGGATGCAGTTCAGAGTGGATTCAGAAACTGGTTACTCAGCCAATTCGACGTGTTCTTCACTGGTATATTCACGCTGGAGCTGTTTCTGAAGCTGGTGACGTACGGGCTGATCCTCCACCAGGGTGCCTTTCTGCGATCCGCCTTCAACGTTCTCGACATGCTGGTCGTTTGCGTATCGCTTGTGTCTATGAATCTTAAGTCTGGTAGTATATCCGTGGTGAAAATATTACGAGTGTTCAGGGTGCTCAGACCGCTCAGGGCTATCAACAGGGCGAAGGGTCTTAAGCACGTTGTACAATGCGTGATCGTTGCAATCAAAACAATCGGAAACATATTATTGGTTACATCGTTACTACAGTTCATGTTTGCCGTGATGGGAGTCCAAATGTTCAAGGGTAAATTTTTTAGATGTAATGATATTTCTAAGATGACAAAAGAAGAATGTCAGGGAACCTATTTAGTATTTGAGAATCGTAATTACGTTGTAAGAGACCGGGAATGGAAACGCAACGACTTTCATTTCGACAATGTGATGAAGGGAATGCTTACTTTGTTCACTGTGTCGACGTTTGAAGGCTGGCCAGGGTTGCTGTATGTTTCAATAGATTCAAATGCGGAGGATCGCGGTCCCATAACTAACTTCCGTCCAATTGTTGCAGCCTACTACATTATTTATATTATTATAATTGCCTTCTTTATGGTAAATATATTCGTGGGTTTCGTCATAGTGACATTCCAAAACGAGGGTGAACAGGAATACAAGAATTGTGAACTAGACAAGAATCAGAGAAACTGTATTGAGTTTGCGTTGAAAGCAAAGCCGATCAGAAGGTACATTCCCAAGCACCGCATTCAATACAAAGTGTGGTGGTTCGTCACCTCACAGCCGTTTGAATATGCGATCTTCGTCCTCATCATGATCAACACCATCACGTTAGCCATGAAGTACCACAACCAGTCCATCGAATATAGCAAGGCTTTGGACATGCTCAATATGTTGTTCACGGCCGTTTTTGCCTTGGAGTTCATATTCAAACTAGCTGCGTTTAGATTTAAGAACTACTTCGGGGACGCTTGGAACACCTTTGACTTCATTATAGTACTCGGAAGCATCATTGATATAGTCGTTTCGCAAGTAAACGAATTGAAGAATCAGGGAAGTGGCATGCCCAGAATACATGTTGTAAAGGAGAGCTCAATACCGTCGATAAACTTCTTCCGTTTGTTTCGTGTGATGAGACTCGTGAAGCTGCTGTCCAGGGGCGAAGGCATCAGAACGTTGTTGTGGACCTTCATAAAGTCGTTCCAAGCCCTCCCGTACGTCGCTCTGCTGATACTGATGCTGTTCTTCATTTATGCTGTTGTGGGCATGCAGGTATTCGGAAAGATAGCAATAGACGACAATACTCCGATCACAAGGAACAATCACTTCCAGACATTCCCGCAGGCTATATTAGTGTTATTCAGATCTGCCACAGGTGAAGCATGGCAGGACATCATGATGGGAGTGTCGCCAGACTCTGAGGTCAAGTGCGATAAGAATTACCACGAGGAAGTGGGAGAGGATAGCGAAGGCACCTGTGGAAGTGTATTAGCATTCCCATATTTTATATCATTTTATGTGTTATGTTCTTTTCTGATTATCAATTTATTCGTTGCGGTCATTATGGATAACTTTGACTATCTAACTAGAGATTGGTCAATATTGGGACCACACCACTTAGATGAATTTATAAGACTTTGGAGCGAATATGACCCTGACGCAAAGGGTAGAATAAAACATTTAGATGTAGTTACTTTACTAAGAAAAATAAGTCCGCCTTTGGGATTCGGCAAGCTCTGTCCTCACCGCGTTGCCTGCAAACGACTAGTTTCCATGAACATGCCTCTCAATTCAGATGGCACTGTTCTCTTCAACGCTACACTGTTCGCCGTCGTCAGAACTTCATTGAAGATTAAAACGGATGGTAACATTGACGACTGCAACACAGAATTAAGAGCAGTGATAAAGAAAATCTGGAAACGCACATCACCAAAACTCCTGGACCAAGTAGTTCCTCCACCAGGCGACCCCAACGAGATCACAGTCGGAAAGTTCTACGCCACCTTCCTAATCCAAGACTACTTCAGGAGGTTCAAAAAGCGGAAAGAACAAGAATTAAGGCAAAATGATGAGCAAACGCATCAGATGACGCTGCAAGCCGGATTGAGGACTTTGCATGAAGCCGGGCCGGAACTAAAGAGGGCTATCTCTGGTAATCTGGATGATATAACGGCCGAGTTAGATGTACCTATGCATAGGAGAAATCACTCGCTGTTTGGAGGTGTCTGGTCAAGTATACGACGGCACGGTCCTAACAGACATCTTCATAGACACAGAAAAGAGCCGCCGCCAGAGGCTGTTGGCAATCATTTAAGCTCCTTAATGCAGAAAGAATATGGGGTTGGACCGTTGCCGCTGACACCCAATTTGGCAAACGGACAACCAAAAGAACAGATACCAATGAGGCCTCTTATACTAAACGGTGAATCAGAAAAAATATATCAAGTCTTAGACAACCAAAAGTCGAACTACCCCGAAATGCTCGGGCAGATCGGGCTCGCGTTCGGGTGCGTGAACTACTTGTCGGCGGCGGGAGGGAGCTCGCGACAACGCGTCCACCCAGAGGACGACGAGCGAGCGGAGACGATCCAGCCGAAGATATCGCCGCTGCTGGCGAGCGCCTGCACTCCCACGACGGAGGCGCGCACGATGACGCTGTACGGCTACAACGCGGCGGCGCGGTTACCGTTCGCGTTCTCTCACGGCGGACGCCGGTCGCTCCGCGCGTGTCGCACGGCGCCGGCGGTGGCAGGAACCGATAGCGCTGGTCGAGGCGTTGTATCGCTGCCAGGAAGTCCCCGCGGAAACAGCTCCTCATTACCAGTAGTAGGCTCCGCAGAAAGCCTAGTCACTAGAGTGTTGACTGAACAAGGACTAGGAGAATACTGCGATCCAGAGTTCGTCAGGAACACTTCTAGAGAGATGCAGGAAGCACTCGAGATGACAGAAGAGCAGATGGACAGAGCGGCTCATCAGCTGATGATTCACGAAAAGAATTTGAAGCAAGCTCAATGTCAACCAACTCAAGTTGGCGACATCGTAGCCCGCAAGTTCCACCCTTTTCACCAGCCAACATCGATGCCTCCCCCGGCCTGCGAGCGGTTATAG
Protein
MNANGDSQGLVPAAPATTPTAPPITTPPAHVDGSLLPIPPVAPRKPVRRGAKAQPERPKRALFCLTMKNPLRKVCVDIVEWKPFEWMILTTIFANCIALAVYTPYPASDSNYTNWVLEKIEYVFLVIFTGECVMKIIAYGFVMHPGSYLRNGWNLLDFTIVVIGMVSTVLSSIFKDSFDVKALRAFRVLRPLRLVSGVPSLQIVLNSILKAMVPLLHIALLVIFVIIIYAIIGLELFSGKMHKSCFNKYTDEIMDSPHPCDNDNGFNCSSLGPEMECREGWPGPNFGITNFDNFGLSMLTVFQCITLEGWTDVMYNIQDAMGNSWEWIYFVSMVILGAFFVMNLILGVLSGEFSKEREKAKNRGDFQKLREKQQLEEDLKGYLDWITQAEYLEPVDQHDNSNQKGDFGGPTQNEHDSTDHLGVETVEPQKVSISWKKDFDKVNRRMKRACRKAVKSQTFYWLIIVLVFLNTVVLASEHYRQPEWLDHFQEYGNAFFVALFTLEMLVKMYSLGLQGYFVSLFNRFDCFVVIGSISEMVLTKSEVMPPLGISVLRCVRLLRVFKVTKYWRSLSNLVASLLNSIQSIASLLLLLFLFIMIFALLGMQVFGGKFNYDPVEEKDRHNFDCFWQALLTVFQILTGEDWNAVMYEGIKAYGGAGTVGIVACIYFIILFICGNYILLNVFLAIAVDNLADAESLTNIDKEEGACEEKEESMVAIEGVQGDTDDEYIHDDEAYTTDNSEREYEETGSEGDPQDEIEEEEEEELDENELEDRVEEEQERDEDMEMMEGHQRNHIDGGKSEEEGKLVTARPRRISELNMPNQTPPIPNASSFFIFSPTNRFRVLCYKLSSSSTFGNIILVCIMLSSAMLAAEDPLDAVQSGFRNWLLSQFDVFFTGIFTLELFLKLVTYGLILHQGAFLRSAFNVLDMLVVCVSLVSMNLKSGSISVVKILRVFRVLRPLRAINRAKGLKHVVQCVIVAIKTIGNILLVTSLLQFMFAVMGVQMFKGKFFRCNDISKMTKEECQGTYLVFENRNYVVRDREWKRNDFHFDNVMKGMLTLFTVSTFEGWPGLLYVSIDSNAEDRGPITNFRPIVAAYYIIYIIIIAFFMVNIFVGFVIVTFQNEGEQEYKNCELDKNQRNCIEFALKAKPIRRYIPKHRIQYKVWWFVTSQPFEYAIFVLIMINTITLAMKYHNQSIEYSKALDMLNMLFTAVFALEFIFKLAAFRFKNYFGDAWNTFDFIIVLGSIIDIVVSQVNELKNQGSGMPRIHVVKESSIPSINFFRLFRVMRLVKLLSRGEGIRTLLWTFIKSFQALPYVALLILMLFFIYAVVGMQVFGKIAIDDNTPITRNNHFQTFPQAILVLFRSATGEAWQDIMMGVSPDSEVKCDKNYHEEVGEDSEGTCGSVLAFPYFISFYVLCSFLIINLFVAVIMDNFDYLTRDWSILGPHHLDEFIRLWSEYDPDAKGRIKHLDVVTLLRKISPPLGFGKLCPHRVACKRLVSMNMPLNSDGTVLFNATLFAVVRTSLKIKTDGNIDDCNTELRAVIKKIWKRTSPKLLDQVVPPPGDPNEITVGKFYATFLIQDYFRRFKKRKEQELRQNDEQTHQMTLQAGLRTLHEAGPELKRAISGNLDDITAELDVPMHRRNHSLFGGVWSSIRRHGPNRHLHRHRKEPPPEAVGNHLSSLMQKEYGVGPLPLTPNLANGQPKEQIPMRPLILNGESEKIYQVLDNQKSNYPEMLGQIGLAFGCVNYLSAAGGSSRQRVHPEDDERAETIQPKISPLLASACTPTTEARTMTLYGYNAAARLPFAFSHGGRRSLRACRTAPAVAGTDSAGRGVVSLPGSPRGNSSSLPVVGSAESLVTRVLTEQGLGEYCDPEFVRNTSREMQEALEMTEEQMDRAAHQLMIHEKNLKQAQCQPTQVGDIVARKFHPFHQPTSMPPPACERL

Summary

Description
Voltage-sensitive calcium channels (VSCC) mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, gene expression, cell motility, cell division and cell death.
Voltage-sensitive calcium channels (VSCC) mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, gene expression, cell motility, cell division and cell death. Encodes a dihydropyridine- and diltiazem-sensitive current in larval body wall muscle. Vital for embryonic development.
Voltage-sensitive calcium channels (VSCC) mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, gene expression, cell motility, cell division and cell death (By similarity). MDL-alpha1 encodes a dihydropyridine- and diltiazem-sensitive current in larval body wall muscle.
Similarity
Belongs to the calcium channel alpha-1 subunit (TC 1.A.1.11) family.
Keywords
Alternative splicing   Calcium   Calcium channel   Calcium transport   Complete proteome   Glycoprotein   Ion channel   Ion transport   Membrane   Metal-binding   Phosphoprotein   Reference proteome   Repeat   Transmembrane   Transmembrane helix   Transport   Voltage-gated channel  
Feature
chain  Voltage-dependent calcium channel type D subunit alpha-1
splice variant  In isoform B.
Pfam
PF16905   GPHH        + More
PF00520   Ion_trans
PF08763   Ca_chan_IQ
PF16885   CAC1F_C
Interpro
IPR031688   CAC1F_C        + More
IPR005446   VDCC_L_a1su       
IPR002077   VDCCAlpha1       
IPR031649   GPHH_dom       
IPR005821   Ion_trans_dom       
IPR027359   Volt_channel_dom_sf       
IPR014873   VDCC_a1su_IQ       
IPR000731   SSD       
IPR029033   His_PPase_superfam       
SUPFAM
SSF53254   SSF53254       
Gene 3D
PDB
5GJW     E-value=0,     Score=2800

Ontologies

Topology

Subcellular location
Membrane  
Length:
1943
Number of predicted TMHs:
18
Exp number of AAs in TMHs:
430.895879999999
Exp number, first 60 AAs:
0.03414
Total prob of N-in:
0.37439
outside
1  -  85
TMhelix
86  -  108
inside
109  -  119
TMhelix
120  -  142
outside
143  -  151
TMhelix
152  -  174
inside
175  -  214
TMhelix
215  -  237
outside
238  -  326
TMhelix
327  -  349
inside
350  -  458
TMhelix
459  -  476
outside
477  -  490
TMhelix
491  -  513
inside
514  -  583
TMhelix
584  -  606
outside
607  -  656
TMhelix
657  -  679
inside
680  -  846
TMhelix
847  -  869
outside
870  -  888
TMhelix
889  -  911
inside
912  -  973
TMhelix
974  -  996
outside
997  -  1096
TMhelix
1097  -  1119
inside
1120  -  1161
TMhelix
1162  -  1184
outside
1185  -  1203
TMhelix
1204  -  1223
inside
1224  -  1235
TMhelix
1236  -  1253
outside
1254  -  1310
TMhelix
1311  -  1330
inside
1331  -  1406
TMhelix
1407  -  1429
outside
1430  -  1943
 
 

Population Genetic Test Statistics

Pi
213.9461
Theta
167.134326
Tajima's D
0.795251
CLR
0.369378
CSRT
0.60141992900355
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号