SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15841
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_uncharacterized_protein_LOC106708942_[Papilio_machaon]
Location in the cell
Mitochondrial   Reliability : 1.076 Nuclear   Reliability : 1.596
 

Sequence

CDS
ATGGCCAGTTTAAAAAAGTTATTACCCCAGGAGGGTACCTCCCGCTCAGCGGGAGGAGAATCCCTCCGTGTGGCCGACTCGTCGGACGCACGCTGCCCCGCGTACTCTGGGGGGGGCAAAAACTGCCTAGACGTCAGGTCCGGGAAGGACGGAGTTCAAAAGAAGAAAATTATGTCCGAGAAGGACCCTGAAGTAAGCTCCTTAAGAGCCGATGTCGTGTCGGACAACGATATGGCCACAGTTGGTTCGGCCCAGTCGTCGACCCATTCGTCGCCGACACGACGACGGCGGAAAAGGGTGCTCAATATAAGCTCGGACGGGCTGAGTAGCAGCTCCGGCTCGGAGGCTCAGGATCCGACAGGTGTGAAGCCCAGAGCAGTCACGCCGTCAAAGCGTGGACGGGGACGCCCTGCGACCACAGGGCAGTACGTTGGCATGGCCGCTGCCAGGCAAGCGTACCTCAAGGCACAAAAAGAGGAGAAGGAGCTCACTGAGAGTGCGCGCACCACACGCCACAAGAGGAGAGCGGCTGAAGGGTCTGTCCCTAAGCCCGATGCCGAGCGTAGGCTCCATCAAAGTGCAGAGGTGGCCCTGATGGTCGCCGCCAAATCCAGCAGCCCGAAGGGCACGTACGTGCGTGCACTGAAGGAGTTGGCAGTCACTGTCAAGGAGGCCACGGAGGACCTTGTGGGCTACACCGCAGCCGAAGAGGCTAAGAGACTGCGAGCGGTCAACGTCAAGCAGGAGCAGGAGATCCTGCAACTGCGTAAGGAGCTCGATGAAGTTAGAAGGGAGTTGGCGAGGGTTTCGCAGGTGCTAGCGTTGCCCACATCGACTGCGACCCCGGCCCCGAACCCCAAGGAGGAAGAGGAGGAGTTGCGCCTACAGCGCATTATGCGAGCTGTCGGCACTATGCTCGACGCTCGCTTTGAAGGGCTGGAGGCACGGCTTCTACCGGAGCCCCGAATGCGACCACCGCTAGCGGCGGACAAGCAGAGGAGCCGGGAAGAATCGTCTAATCCCCCTGTCGTCGTTGACGCTGCACCGGATGCGGCACCGTCATCAGTGCCACCGATGACATTGGCGAAAAAGAGGATGCGTGGCCCCAAGAGACGTGTCACCGCGCAAGCGGCTTCATCCGAAACGCACACCGTCCTCCCGGCTCCAGCTTCCATGATCGAGAGCTGGTCAACGGTCACCCGTAGGGGTGCTCGACCGAGGGAGGAAGCAGTGAGGACGGTTCCAGCGGCAGCTATCGCTGAAGCGGAAAGGAAAGACCGGTCTTCTGTAAAGAGGAAAGAGAAGAAGCTGCGCCCTCCACGCACTCAGGCCGTTGTCCTCAAACTGCAACCAGAGGCCGTGGAAAGAGGACTCACGTACCGCACTGTACTCGCCGAAGCGAGGGCCAAGGTAGATCCTGGGGCACTTGGAATACCCATCCAGCGCATCCGGTCTGCAGTGACTGGGTCTAAGGTGCTGGTAGTGGAAGGTGCAGACCAGAGCGCCAAGGCCGATCTCCTGGCCCAAAAGCTTCGTGAGGTTCTGCCCGCAGAAGGGGTAATAGTGACCAGGCCAGTAACGACTGCAGCCATCCGCATCAGCGGACTGGACGACTCCCTGATGCCAGAGGAACTTACCGCGGAGCTTGCCCGGATTGGCGAATGCGCTCCTGATGCGGTGAAGATCGGAGACATCAAGTATGGCCCAGGCGGGATGGGTCAAGTATTGGTCCGGTTGCCCGTCGTTGCCACGATGAAGGTTCTCGCCGTTCCAAAACTGAGGGTTGGTTGGAGCGTGCTCCGCGCTTGTTTGTTAGAGGCTAAGAAGCTACAGTGCTTCCGATGCCATGAGCTAGGGCACGTGAGCGCCCGATGTCCTTCGTCGGTCGACCGCAGCCGGGATTGTTATCGGTGCGGCCAGACCGGCCACGTAGCGGCCGGCTGCTCCCTTGCACCACACTGCGCTGGGAATCTCAACCATTGCGCCAGAGCTCAGGACCTTTTGTTCCAGAGCATGGCGGAGGGGTTGACCCATCTTGCGGTGGTCGCCGAGCCGTATCGGGTCCCTTCGAGCCCCGATTGGGCGGCCGATTTGGAGGGCCGAGTGGCAATCATCCGGCGTTGTTGTGTGGGTGCTCCGCCTACGTTTGCCGTTGTTGAAAGAGGTCGCGGCTTCGTTGCCGTCCTCTGGGCCGAGATATTCGTGTTGGGAGTGTACTTTTCCCCAAACAGGACGCTCGCCGAGTTTGAGGTTTTCCTCAGCGAGCTCAGCCGCGTCGTTGGAAGGTCGCACTTCCGACGGATTCTCGTTCTGGGTGACCTAAATGCCAAGTCATTGTCTTGGGGTTCCTCTAGGACGTGCCCCAGAGGTAGAGCGGTGGAGGAGTGGCTGGTCGGAAGCGGTCTCCTCATCCTCAATCGCGGTACGGAACTCACATGCGTGCGACGTTTGGGCGGGTCCGTGGTGGACGTTACATTCGCCACGCCTGACGTCGCATATCGCGTACGCGGTTGGGCGGTGATGGTTGGCGAGGAGACCCTCTCCGACCACCGTTACATCCGATTCAGTGTCGCCGCGACCCCGGTGGGTTCTGTTCGGGGCTTTTCCTTGCCCATCAGTGGCAGCGCTAGGGGTCCTCGTTGGGCCCAGAAGCGCCTCAACATCGAGCGGTTGCGTGAGGCGGCCATAGTGCAGGCGTGGCGTCTTGACTCGCTTGGCGAGCCAGCAGACGTGTGCGAGGGGGTGGAGCGTCTGCGCGAGGCAATGTCACGGGTGTGTGACGCTGCTATGCCTCGCGTGAGAGCTCTCGCTCCTAAGCGCCAAGTTCATTGGTGGACCGAGGAGATCGCCAGCCAGCGCCGGCTATGCGATATTAGTCGTCGCACATACCAGCGATATCGACGACGAAGAACGCGCCGGGACCCCAACGAGGAGGACCGCCTGTACGAAGTGTACAGGATGGCGATAAGAACCCTGCGCTTGGCTATCGGGGAGGCGAAGGAGGCCGCCTGGAACGACCTACTGGCCTCGCTGGACCGTGACCCGTGGGGGCGGCCCTACAGGCTGGCGCGTAATGCGCTTCGCCGTTGGGCTCCTCCCGCAACCAGCACCCTGCCGCCGGAAACATTGCAGCGGGTAGTCGGGGGTCTGTTTCCCGATTTATCCGGGACGGCCTTCGTCCCCCCTGTGATGACAATGGCGCGGATTGCTGATAGCGAAGAGCTTGAGGACGTCTCCCAGGTGGAGTTCGATTTGGCTGTGCAGAGGATGCGGGCTAAGCGCACGGCACCCGGTCCCGATGGGATCTCGTCCCAAGCGTGGGCGCTCGCCTTGACAGGTGACGGCTTGGCCCTCCGTGAGGGCAGGTTCCCAGAGCCATGGAAGACTGGTCGGCTTGTCCTTATTCCTAAGGAAGGCCGGCCACGTGACGAGCCAAGCGGGTACCGTCCAATCGTCGTGCTGGACGAGGCTGGTAAGCTCCTCGAGCGCATCGTCGCCAGTCGCCTCGTCCAGCACCTCGAAAGCGTTGGGCCTGACCTGGCTCCTAACCAATATGGTTTCCGGAGAGGTCGCTCCACCATGGACGCGGTCTTGCGCGTCCGCCACCTCTCCGATCGTGCGTGCTCCGAGGGGGGCGTGTTGTTGGCTGTGTCGATTGATATCGCCAACGCCTTCAACACGATCCCTTGGAGCACGATCGTGGAATCGCTCCGGTTTCACCGCGTCCCCCCTAGTCTCCGGACCCTGATAGAGGATTACCTCTCAGGGCGAAATGTAGTCTTCCCCGAGAGGAGGGGGTGGGGACGGAAAGCGGTGTCGTGCGGGGTCCCGCAGGGGTCGGTACTGGGACCACTCCTGTGGGACATCGGTTTCGACTGGGTCCTGCGCGGTGCTAGCCTGCGTGGCGTCGACGTAGTGTGCTATGCCGACGACACGCTGGTGACGGCCCGCGGAGCCGACTACAGAGCCGCAGCGATCCTTGCGACGGCGGCGGTCTCCACCGTCGTTAGTCGCATTCGGAGATTAGGTCTTGAGGTGGCCCTCCGCAAGTCCGAAGCGGTGTGCTTTCACCCAGTCCGGAGGGGACCTCCTCCGGGAGCGAGTCTCATAGTCGGCGGAGTATCGATCGCTGTCCAGCCGAAGCTCAAATATTTGGGCCTTGTGCTGGACAGTCGATGGCGCTTCGACCACCACTTTGGTGAGTTAGTCCCGAAGCTGCTGGGGATGGCGGGCGCACTAGCCCGTCTTCTCCCCAACGTCGGTGGTTGCAGCGCCGGCGTCCGGCGTCTGTACCTGGGGGTCGTGCGCAGTATGGCTTTGTACGGCGCTCCCGTGTGGTCGCCCGCACTCTCTGCGCGCAATGCAGCTTTGCTGCTACGAGCGCAGCGGGTGCTCGCGGTGAGAGTCATCAGGGGGTACCGTACGATCTCCCGGGAGGTCGCCTGCGCCCTCGCCGGTTCCCTTCCTTGGGATCTCGAGGCTGAGGTAGCAGCTGCGGTATACCGGCGCAGAACACAGTCCCTGAGTCGGGGACGGACGCCCGGCCCGTCGGCTGTCGGTCGGTGGAGGCGTGCTGCGCGTCATCTGGCGTACGCCAAGTGGAGGGAGCGGTTGCTGGAGGAGCTTGGCCAAACGTCAGTCACTCGCCGACGCACCCTCGAGGCCCTGGTGCCCGTGCTGGAGGCATGGTCAGATAGACGACACGGCGTGCTCTCCTACCACTTAACGCAGGTCCTCTCGGGGCATGGCTGCTTCGGGAGGTACCTGTGGAAGGTCTGCAGGAGAGAGCCACATCCGGGTTGCCACCAGTGCGGGCATCCGGACGATGACGCTCAGCACGCACTCGAAGCGTGCCCGCGTTGGGAGCGCTCGCGGCGAGACCTCATCGCGGTGCTGGGGGGAGACCTCTCCTTGCGGGCTGTCATCGCCCGCATGCTAGAGGACCAGAATTCTTGGGAGGCCATGACCAGGTTTTGCGACCTGGTCATGGCGTTCCGTGAGGCTGAGGAGCGCGAAAGGGAGTGGGATCCCTCTTCGGCTTCACAGCGAAGAAGGCGGAGTGGGCGGCACGGGCGCGAAGCTCCCGTTCATCTCCCGTAG
Protein
MASLKKLLPQEGTSRSAGGESLRVADSSDARCPAYSGGGKNCLDVRSGKDGVQKKKIMSEKDPEVSSLRADVVSDNDMATVGSAQSSTHSSPTRRRRKRVLNISSDGLSSSSGSEAQDPTGVKPRAVTPSKRGRGRPATTGQYVGMAAARQAYLKAQKEEKELTESARTTRHKRRAAEGSVPKPDAERRLHQSAEVALMVAAKSSSPKGTYVRALKELAVTVKEATEDLVGYTAAEEAKRLRAVNVKQEQEILQLRKELDEVRRELARVSQVLALPTSTATPAPNPKEEEEELRLQRIMRAVGTMLDARFEGLEARLLPEPRMRPPLAADKQRSREESSNPPVVVDAAPDAAPSSVPPMTLAKKRMRGPKRRVTAQAASSETHTVLPAPASMIESWSTVTRRGARPREEAVRTVPAAAIAEAERKDRSSVKRKEKKLRPPRTQAVVLKLQPEAVERGLTYRTVLAEARAKVDPGALGIPIQRIRSAVTGSKVLVVEGADQSAKADLLAQKLREVLPAEGVIVTRPVTTAAIRISGLDDSLMPEELTAELARIGECAPDAVKIGDIKYGPGGMGQVLVRLPVVATMKVLAVPKLRVGWSVLRACLLEAKKLQCFRCHELGHVSARCPSSVDRSRDCYRCGQTGHVAAGCSLAPHCAGNLNHCARAQDLLFQSMAEGLTHLAVVAEPYRVPSSPDWAADLEGRVAIIRRCCVGAPPTFAVVERGRGFVAVLWAEIFVLGVYFSPNRTLAEFEVFLSELSRVVGRSHFRRILVLGDLNAKSLSWGSSRTCPRGRAVEEWLVGSGLLILNRGTELTCVRRLGGSVVDVTFATPDVAYRVRGWAVMVGEETLSDHRYIRFSVAATPVGSVRGFSLPISGSARGPRWAQKRLNIERLREAAIVQAWRLDSLGEPADVCEGVERLREAMSRVCDAAMPRVRALAPKRQVHWWTEEIASQRRLCDISRRTYQRYRRRRTRRDPNEEDRLYEVYRMAIRTLRLAIGEAKEAAWNDLLASLDRDPWGRPYRLARNALRRWAPPATSTLPPETLQRVVGGLFPDLSGTAFVPPVMTMARIADSEELEDVSQVEFDLAVQRMRAKRTAPGPDGISSQAWALALTGDGLALREGRFPEPWKTGRLVLIPKEGRPRDEPSGYRPIVVLDEAGKLLERIVASRLVQHLESVGPDLAPNQYGFRRGRSTMDAVLRVRHLSDRACSEGGVLLAVSIDIANAFNTIPWSTIVESLRFHRVPPSLRTLIEDYLSGRNVVFPERRGWGRKAVSCGVPQGSVLGPLLWDIGFDWVLRGASLRGVDVVCYADDTLVTARGADYRAAAILATAAVSTVVSRIRRLGLEVALRKSEAVCFHPVRRGPPPGASLIVGGVSIAVQPKLKYLGLVLDSRWRFDHHFGELVPKLLGMAGALARLLPNVGGCSAGVRRLYLGVVRSMALYGAPVWSPALSARNAALLLRAQRVLAVRVIRGYRTISREVACALAGSLPWDLEAEVAAAVYRRRTQSLSRGRTPGPSAVGRWRRAARHLAYAKWRERLLEELGQTSVTRRRTLEALVPVLEAWSDRRHGVLSYHLTQVLSGHGCFGRYLWKVCRREPHPGCHQCGHPDDDAQHALEACPRWERSRRDLIAVLGGDLSLRAVIARMLEDQNSWEAMTRFCDLVMAFREAEEREREWDPSSASQRRRRSGRHGREAPVHLP

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF00098   zf-CCHC
PF00075   RNase_H
Interpro
IPR001878   Znf_CCHC        + More
IPR036875   Znf_CCHC_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR012337   RNaseH-like_sf       
IPR002156   RNaseH_domain       
IPR036397   RNaseH_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D
PDB
1WDU     E-value=7.30505e-08,     Score=142

Ontologies

Topology

Length:
1699
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.05212
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00003
outside
1  -  1699
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.080971
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号