SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15809
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 1.079 Mitochondrial   Reliability : 1.066
 

Sequence

CDS
ATGTTAATACAGACAAACAATATTTTCGAGGCGGTCCGTCCGGTCCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTGACGCAAATGTTGACCGGCCATGGTTGTTTTGGCCGGTACTTGCACAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCATCACTGCGCGGACCGCGACGAGGATGACACAGCGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATAGGTGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGCACGTCCCGGCCCCTGTAG
Protein
MLIQTNNIFEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLHKIAGREPTAQCHHCADRDEDDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPL

Summary

Cofactor
FAD
Similarity
Belongs to the FBPase class 1 family.
Belongs to the GMC oxidoreductase family.
EMBL
AB126050    BAD86650.1    AB090825    BAC57926.1    ODYU01003322    SOQ41921.1    + More
KZ150308    PZC71477.1    KZ149922    PZC77701.1    LBMM01016102    KMQ84557.1    LBMM01005707    KMQ91279.1    RSAL01000006    RVE54258.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    LBMM01009501    KMQ88083.1    LBMM01006538    KMQ90523.1    AB078935    BAC06462.1    ODYU01006757    SOQ48893.1    KZ150386    PZC71062.1    RSAL01003504    RVE40273.1    AB078930    BAC06454.1    AB078931    BAC06456.1    QOIP01000009    RLU18544.1    QOIP01000014    RLU15083.1    KZ149918    PZC77857.1    RSAL01000109    RVE47213.1    KZ149950    PZC76665.1    AB078929    BAC06452.1    LBMM01008861    KMQ88580.1    RSAL01000014    RVE53298.1    RSAL01000481    RVE41577.1    ODYU01007528    SOQ50378.1    ODYU01004308    SOQ44039.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    GL450953    EFN80213.1    PZC77700.1    LBMM01006909    KMQ90209.1    ODYU01009945    SOQ54696.1    LBMM01001564    KMQ96079.1    D85594    BAA19776.1    ODYU01005115    SOQ45661.1    ODYU01008140    SOQ51495.1    ODYU01006342    SOQ48109.1    ODYU01004693    SOQ44845.1    ODYU01005282    SOQ45985.1    LBMM01006022    KMQ91008.1    LBMM01003679    KMQ93242.1    LBMM01003452    KMQ93523.1    ABLF02006132    LBMM01005733    KMQ91252.1    QOIP01000012    RLU16027.1    LBMM01006725    KMQ90373.1    QOIP01000007    RLU20280.1    LBMM01004505    KMQ92346.1    QOIP01000002    RLU25407.1    LBMM01006662    KMQ90413.1    LBMM01002480    KMQ94776.1    LBMM01006996    KMQ90129.1    LBMM01008349    KMQ88951.1    LBMM01019838    KMQ83439.1    LBMM01007036    KMQ90099.1    LBMM01006110    KMQ90925.1    LBMM01006534    KMQ90528.1    LBMM01019839    KMQ83438.1    QOIP01000031    RLU14697.1    LBMM01004272    KMQ92618.1    LBMM01006671    KMQ90407.1    GGMR01014195    MBY26814.1    LBMM01006657    KMQ90417.1    LBMM01008278    KMQ89009.1    QOIP01000010    RLU18098.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF00316   FBPase
PF01553   Acyltransferase
PF01421   Reprolysin
PF07776   zf-AD
PF00096   zf-C2H2
PF03372   Exo_endo_phos
PF00650   CRAL_TRIO
PF00732   GMC_oxred_N
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR033391   FBPase_N       
IPR000146   FBPase_class-1       
IPR028343   FBPtase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR001251   CRAL-TRIO_dom       
IPR036865   CRAL-TRIO_dom_sf       
IPR036273   CRAL/TRIO_N_dom_sf       
IPR006759   Glyco_transf_54       
IPR036188   FAD/NAD-bd_sf       
IPR012132   GMC_OxRdtase       
IPR000172   GMC_OxRdtase_N       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF52087   SSF52087       
SSF46938   SSF46938       
SSF51905   SSF51905       
SSF53098   SSF53098       
SSF57756   SSF57756       
PDB
4XVM     E-value=0.0218335,     Score=83

Ontologies

Topology

Length:
159
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.009
Exp number, first 60 AAs:
0.00296
Total prob of N-in:
0.11861
outside
1  -  159
 
 

Population Genetic Test Statistics

Pi
11.492488
Theta
12.345701
Tajima's D
0.13265
CLR
0.109074
CSRT
0.413429328533573
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号