SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15799
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.042 Mitochondrial   Reliability : 1.045 Nuclear   Reliability : 1.684
 

Sequence

CDS
ATGGAAGAAATAATAACCACCCTACGCTTAATTCAAAAAGATCTCGAAGACCAAAAAATCGCAATAAAGGAAAGCGGTATAGAAGTTGCAAAAACAGTTACGGATAATGTGAATCTGATTTTAGACGAAAAAATAAGTCAACTTGAACAAAAATATAAAACCCTAGAAGAACAATTTGAAATGCAGGAACAAAGACTTCATATATTGGAGAAACAGGCAAGAAATCGAAATATTGTATTTTTTGGCATTGAAGAACACAACTCAATCTACTCTTACTCGGATTTAGAAACGGAAATTATTAATTTCACATCAAAATATCTGGGAATCAAACTAGACCGAAAAGAAATTCAAGAAATCAGAAAAATAGGGAAAAATACAAAGAAACCTAGGCCTATTGTTATGACACTGACCACAGTTGGTAGAAAAATTGAAATTCTCAAACAAAAGAAGCTATTGAAGGATTCAAACTACTACATTAAGGAAGATTACCCACAGCATATTCTAGAGAAACGGAGAATGCTACAGGAACAAGTAAAAGTTGAAAGAGATAAGGAGGAACTTGAGATTATACAAGCAGCTGATAAGTTAAAATTTGAGAAGAGCCCAGGCCCAGATTTCATTACTAATGAAGCAATCAAACATGGATGTGAAATACTTGCATCACCACTGGCCTCATTATTTAATCTGATACTCAAAACTGCGAATATACCTGCACAATGGTCAGAATCCATTATAATCTTGCTGTATAAAAAAGGTAACCCTAATGACATTAGCAATTACAGGCCAATAAGCCTTTTGGCAACTGTTTACAAGCTTTTCTCTTCCATAATTAATCGAAGAATATCTGAAACTTTAGAAAAGAGACAGCCCATAGAGCAAGCTGGCTTCCGTAAGGGATATTCAACCGTAGACCACATACACACGCTGGAACTTATTATCGAAAAATACCAAGAGAAGCAAAGACCGCTCTATATAGCTTTTATAGATTACCAGAAGGCTTTCGACACAATTTCACACACAAGCATATGGGAGGCATTAAATCAACAAGGAGTGGAAAGTGAGTATATACAAGTTATAAAAAATATATATAAGAACAGTGTCAGTAAAGTCAAACTGGAAACAATTGGCCCTGATTTTAACATCAATAGAGGAGTGAGACAAGGGGATCCATTGTCTCCAAAACTATTTATTGCAGTATTGGAATCAATTATAAGTCAATTAGACTGGAAAAACTATGGCTTGTATATCAAAGGTGACTGCTTAAGTCATCTAAGGTTCGCAGATGACTTAGTACTGCTATCTGAAACCGGTGGTAACTTAGAGCGCATGATACAGTCATTACACGAAGCTAGCAGACAAGTCGGATTAGAAATTAATCTGAAAAAAACAAACATCATGACAAACAGTTGTAGAAGAACCATCTCACTAGAACACAAACCAATACTGTACGTGGAACAATATATCTACTTAGGAAAGCAGATAGCACTGGACAACAATAGCAATGAACTAGAGGTGGAGCGCAGAACAAGAATTACGTGGAATAAGTTCTGGAGTTACAGAGAAGTAATGAAAAGTAACATGCCAACAGAAGTGAAAAAGAAAATCATGGACACTTGTATATTGCCGTGTCTTACATACGGTTGCCAGACGTGGAAATTTACGCGTAACATTAAAAATAAATTAACAACGTGCCAGAGGGGAATGGAACGCAGCATGCTCAACATAAAAAAGACACACAGAGTGCGTCATACAAAGATAAGAAGCATAACCAAAACAGTGGACGCTCTCAAATATGCTCAAAGACTGAAGTTTAAGTGGGCTGGCCACGTAGCACGACTCAGGGATGGGAGATGGACATCGAAAGTAACTGCATGGGACGGTCCACAGGGCAAGCGGCGCGTCGGCAGACCGTACACGCGTTGGGAGGATGATATTAGAAAGGTTGCTGGACCACACTGGATTTATGTCGCCAGAGACAAAGCAGAGTGGAAATCTTTGGAGGAGGCCTTTACCTGA
Protein
MEEIITTLRLIQKDLEDQKIAIKESGIEVAKTVTDNVNLILDEKISQLEQKYKTLEEQFEMQEQRLHILEKQARNRNIVFFGIEEHNSIYSYSDLETEIINFTSKYLGIKLDRKEIQEIRKIGKNTKKPRPIVMTLTTVGRKIEILKQKKLLKDSNYYIKEDYPQHILEKRRMLQEQVKVERDKEELEIIQAADKLKFEKSPGPDFITNEAIKHGCEILASPLASLFNLILKTANIPAQWSESIIILLYKKGNPNDISNYRPISLLATVYKLFSSIINRRISETLEKRQPIEQAGFRKGYSTVDHIHTLELIIEKYQEKQRPLYIAFIDYQKAFDTISHTSIWEALNQQGVESEYIQVIKNIYKNSVSKVKLETIGPDFNINRGVRQGDPLSPKLFIAVLESIISQLDWKNYGLYIKGDCLSHLRFADDLVLLSETGGNLERMIQSLHEASRQVGLEINLKKTNIMTNSCRRTISLEHKPILYVEQYIYLGKQIALDNNSNELEVERRTRITWNKFWSYREVMKSNMPTEVKKKIMDTCILPCLTYGCQTWKFTRNIKNKLTTCQRGMERSMLNIKKTHRVRHTKIRSITKTVDALKYAQRLKFKWAGHVARLRDGRWTSKVTAWDGPQGKRRVGRPYTRWEDDIRKVAGPHWIYVARDKAEWKSLEEAFT

Summary

EMBL
FJ265563    ADI61831.1    FJ265562    ADI61830.1    ODYU01008249    SOQ51673.1    + More
KZ150317    PZC71439.1    KZ150485    PZC70710.1    FJ265564    ADI61832.1    KZ150108    PZC73382.1    FJ265561    ADI61829.1    KZ149907    PZC78256.1    RSAL01002362    RVE40503.1    ODYU01004088    SOQ43598.1    FJ265549    ADI61817.1    FJ265542    ADI61810.1    FJ265545    ADI61813.1    FJ265544    ADI61812.1    GBBI01004876    JAC13836.1    FJ265550    ADI61818.1    FJ265543    ADI61811.1    MRZV01002136    PIK34564.1    FJ265551    ADI61819.1    MRZV01000899    PIK42833.1    KZ149985    PZC75698.1    UZAG01000503    VDO08661.1    AAGJ04050748    JARK01001340    EYC31295.1    JARK01001677    EYB83167.1    EYB83168.1    JARK01001351    EYC23395.1    JARK01001362    EYC18843.1    EYC18844.1    JARK01001423    EYC04578.1    JARK01001349    EYC24735.1    JARK01001361    EYC19034.1    JARK01001344    EYC28218.1    JARK01001341    EYC29807.1    RSAL01002130    RVE40575.1    JARK01001655    EYB84321.1    JARK01001517    EYB93530.1    JARK01001438    EYC02012.1    JARK01001346    EYC26784.1    JARK01001364    EYC18031.1    EYC31302.1    JARK01001378    EYC13977.1    JARK01001406    EYC07496.1    JARK01001630    EYB85641.1    JARK01001475    EYB97550.1    JARK01000173    EYC41342.1    EYC30223.1    JARK01001568    EYB89432.1    JARK01000077    EYC43894.1    JARK01001380    EYC13322.1    JARK01000302    EYC38674.1    JARK01001470    JARK01000204    EYB98082.1    EYC40602.1    JARK01000388    EYC37469.1    JARK01001434    EYC02684.1    EYB98081.1    EYC40601.1    JARK01001365    EYC18010.1    JARK01001348    EYC25048.1    JARK01001370    EYC16150.1    EYC25050.1    EYC18009.1    JARK01001338    EYC33297.1    JARK01000063    EYC44387.1    JARK01001389    EYC10874.1    JARK01001432    EYC03125.1    JARK01001628    JARK01001583    JARK01001528    JARK01001506    JARK01001467    JARK01001463    JARK01001457    JARK01001420    JARK01001403    JARK01001371    JARK01001369    JARK01001360    JARK01001353    JARK01000603    JARK01000080    EYB85741.1    EYB88438.1    EYB92544.1    EYB94540.1    EYB98080.1    EYB98468.1    EYB98899.1    EYB99568.1    EYC03088.1    EYC05014.1    EYC08153.1    EYC15852.1    EYC16408.1    EYC19456.1    EYC22445.1    EYC24734.1    EYC24778.1    EYC24866.1    EYC33488.1    EYC35672.1    EYC43798.1    JARK01001636    EYB85342.1    EYC28216.1    JARK01001497    EYB95322.1    JARK01000161    EYC41641.1    JARK01001421    EYC04912.1    JARK01001581    EYB88505.1    JARK01001502    EYB94855.1    EYC26445.1    JARK01001372    EYC15614.1    JARK01001401    EYC08686.1    JARK01000046    EYC44894.1    EYB85344.1    JARK01000008    EYC46079.1    EYC30744.1    JARK01001357    EYC20551.1    JARK01001343    EYC28635.1    JARK01001612    EYB86585.1    JARK01000165    EYC41537.1    JARK01000109    EYC42952.1    JARK01001342    EYC29360.1    EYC25049.1    JARK01000256    EYC39462.1    JARK01001500    EYB95040.1    EYC28825.1    EYB95049.1    JARK01001618    EYB86258.1    JARK01001736    JARK01001462    JARK01001379    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    JARK01000132    EYC42415.1    JARK01000347    EYC38051.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF01826   TIL
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR036084   Ser_inhib-like_sf       
IPR002919   TIL_dom       
IPR029052   Metallo-depent_PP-like       
IPR017452   GPCR_Rhodpsn_7TM       
SUPFAM
SSF56219   SSF56219        + More
SSF57567   SSF57567       
Gene 3D
PDB
5HHL     E-value=0.0313428,     Score=90

Ontologies

Topology

Length:
671
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00433
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00035
outside
1  -  671
 
 

Population Genetic Test Statistics

Pi
19.452447
Theta
19.327881
Tajima's D
2.330696
CLR
0.516877
CSRT
0.929703514824259
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号