Gene

KWMTBOMO15761  Validated by peptides from experiments

Pre Gene Modal

BGIBMGA014220

Annotation

casein_kinase_I_alpha_[Bombyx_mori]

Location

Bomo_Chr26(+):9497768-9512238      View in EpiBrowser

Full name

Casein kinase I isoform alpha      

Alternative Name

CK1

Location in the cell

Cytoplasmic   Reliability : 2.059 Mitochondrial   Reliability : 1.806

CDS

ATGTCGTTCCCGTGGAGATCTCGTTCGGAAGTATTGATTTCTGGAAAATACAAGGTGTCGAAAAAGATCGGTGGTGGATCGTTCGGTGATATATATTTGGCTATCAACATCGGAACTGGCGAGGAGGTGGCAGTGAAAGTTGAATCTACAAAGGCCCGACACCCCCAACTTCTCTATGAGAGCAGAGTGTATAAAATGCTCCAAGGGGGTGTAGGCATACCACACATAAGATGGTACGGCTACGAGCGCGAATACAATATCCTGGTCATGGACCTGCTGGGCCCCTCGCTCGAGGATCTCTTCAACTTCTGCACCCGCCAGTTCACGATAAAAACCGTTCTAATGCTTGCAGATCAAATGCTGAATCGCGTCGAGTTCCTCCACTGCAAGTGCTTCATTCACCGCGACATCAAGCCGGACAACTTCCTAATGGGCATCGGCCGGCACTGCAACAAGCTGTACATGATCGACTTTGGACTCGCGAAGAAATACAGAGACCTTCGCACCCGGGCTCACATCTCTTACCGCGAAGACAAAAATCTTACAGGCACGGCGCGCTACGCCTCCATCAACGCCCATCTAGGCATAGAGCAGTCGCGCCGGGACGACATGGAGTCCCTCGGATACGTGCTTATGTACTTCAACAGAGGAGCTCTGCCCTGGCAAGGTCTGAAGGCGATCACGAAAAAGCAGAAGTACGAACGCATCAGCGAAAAGAAAATGTCCACCCCCGTTGAAGTTCTGTGCAAGGGCTTCCCGGCCGAGTTCGCCATGTTCCTCAACTACTGCCGCGGCCTCGCCTTCGACGAGAGCCCTGACTACATGTATCTTAGGCAGTTGTTCCGGATTCTGTTCCGTACGATGAACTATCAGTACGACTACACGTTCGACTGGACGATCCTGCGTCAGCGTAAGCACCACCTGGAGAGCGCAGCCGCCGCCGACCGACGCTCGCCCTCGCTGCAACGCCGCGCCGCGCCCCAGCCGCAGCCGCCGCCCAACAACGAGGTGAAATCCGTACATGCCACCAACGATTCCACCGTCAATAAGCATACCGTTAAAGGACAAGTATCCGTGGCCCAAATGAAGAAAAAAATCAATGCAACTTAA

Protein

MSFPWRSRSEVLISGKYKVSKKIGGGSFGDIYLAINIGTGEEVAVKVESTKARHPQLLYESRVYKMLQGGVGIPHIRWYGYEREYNILVMDLLGPSLEDLFNFCTRQFTIKTVLMLADQMLNRVEFLHCKCFIHRDIKPDNFLMGIGRHCNKLYMIDFGLAKKYRDLRTRAHISYREDKNLTGTARYASINAHLGIEQSRRDDMESLGYVLMYFNRGALPWQGLKAITKKQKYERISEKKMSTPVEVLCKGFPAEFAMFLNYCRGLAFDESPDYMYLRQLFRILFRTMNYQYDYTFDWTILRQRKHHLESAAAADRRSPSLQRRAAPQPQPPPNNEVKSVHATNDSTVNKHTVKGQVSVAQMKKKINAT

Description

Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. Can phosphorylate a large number of proteins. Participates in Wnt signaling. Phosphorylates CTNNB1 at 'Ser-45'. May phosphorylate PER1 and PER2. May play a role in segregating chromosomes during mitosis. May play a role in keratin cytoskeleton disassembly and thereby, it may regulate epithelial cell migration (By similarity).
Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. It can phosphorylate a large number of proteins. Participates in Wnt signaling. Phosphorylates CTNNB1 at 'Ser-45'. May phosphorylate PER1 and PER2. May play a role in segregating chromosomes during mitosis (PubMed:11955436, PubMed:1409656, PubMed:18305108). May play a role in keratin cytoskeleton disassembly and thereby, it may regulate epithelial cell migration (PubMed:23902688).
Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. It can phosphorylate a large number of proteins. Participates in Wnt signaling. May play a role in segregating chromosomes during mitosis. May play a role in keratin cytoskeleton disassembly (By similarity) (PubMed:9022677). Phosphorylates protein custos (PubMed:25157132).
Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. It can phosphorylate a large number of proteins. Participates in Wnt signaling. May play a role in segregating chromosomes during mitosis. May play a role in keratin cytoskeleton disassembly.

Catalytic Activity

ATP + L-seryl-[protein] = ADP + H(+) + O-phospho-L-seryl-[protein]
ATP + L-threonyl-[protein] = ADP + H(+) + O-phospho-L-threonyl-[protein]

Subunit

Monomer. Interacts with the Axin complex. Interacts with TUT1, leading to TUT1 phosphorylation. Interacts with FAM83H; recruits CSNK1A1 to keratin filaments.
Monomer. Interacts with the Axin complex. Interacts with TUT1, leading to TUT1 phosphorylation. Interacts with FAM83H; recruits CSNK1A1 to keratin filaments (PubMed:23902688).
Interacts with custos.

Similarity

Belongs to the protein kinase superfamily.
Belongs to the protein kinase superfamily. CK1 Ser/Thr protein kinase family. Casein kinase I subfamily.

Keywords

Acetylation   Alternative splicing   ATP-binding   Cell cycle   Cell division   Cell projection   Centromere   Chromosome   Complete proteome   Cytoplasm   Cytoskeleton   Kinase   Kinetochore   Mitosis   Nucleotide-binding   Nucleus   Phosphoprotein   Reference proteome   Transferase   Wnt signaling pathway   3D-structure   Direct protein sequencing   Polymorphism  

Feature

chain  Casein kinase I isoform alpha
splice variant  In isoform 2.
sequence variant  In a breast pleomorphic lobular carcinoma sample; somatic mutation.

Uniprot

Q5UAE4   H9JXF4   A0A212ERU7   Q699T5   A0A0Q3URS7   G3Q7M8   + More
F1PUU1   A0A093E8A4   A0A2I0TYY2   A0A093QMH7   G3Q7M6   A0A093NMT1   F6VPH2   A0A093GU85   A0A250XYR2   A0A286XXZ0   A0JPL2   A0A2K6CPS4   A0A2I2ZQU5   G1LFH9   A0A341AVQ2   F2Z4Z4   G3SQD7   A0A2Y9E0S3   A0A2U4AH10   A0A3Q7Q467   A0A340WKC9   A0A2R9C4S3   A0A2K5CCQ0   A0A2Y9FWD0   A0A2Y9HXL4   M3X447   A0A2J8X5Y1   A0A2Y9IS74   A0A2Y9INB2   A0A3Q7UAZ9   W5P5Y5   A0A1S2ZAL5   A0A2Y9PR04   A0A2K5SAB1   A0A384AMZ3   A0A2K6TCH3   H2R587   H9YY07   F7HFL4   A0A222AJF6   Q8BK63   P48729   A0A1L8GXP6   A0A151M6U2   Q75WS8   A0A091FRX0   K7G084   A0A1V4KU22   F1NNY1   A0A091JS33   A0A1S3SV14   V9KMH2   A0A3Q0GE16   E9Q4G7   A0A3Q0CXR0   A0A091DND5   A0A384C8F1   A0A2K5UUJ4   A0A2I3MX56   A0A2K5M6U3   A0A2K5JNP4   K1R720   A0A0N5CMR3   V9HW00   P67963   P67962   A0A3N0YLL8   A0A091TIY5   A0A3B4D197   A0A091RBV9   Q7ZY65   A0A287CT17   A0A2K6CPL3   A0A2K5UUD5   A0A2I3GM73   A0A2K5YKE8   A0A3Q2L8N3   A0A2U4AH82   A0A340WKL1   A0A096MQA6   A0A2Y9HXL9   A0A2K5M6T4   A0A2Y9IKQ1   A0A1S2ZAM0   A0A2K5JNJ1   Q32LI4   A0A3P8YCA6   A0A2R8QUQ3   W5K498   A0A1S3RTF0   A0A1S3RV14   H7BXB1   G3SIN1   A0A2R9C7U0  

EC Number

2.7.11.1

Pubmed

19121390    22118469    16341006    20431018    28087693    21993624    + More
15489334    15057822    15632090    22398555    20010809    30723633    22722832    17975172    20809919    16136131    25319552    25243066    16141072    9522121    21183079    21930935    23806337    25644602    8050587    7797465    15498874    14702039    15372022    1409656    11955436    16964243    18305108    18691976    19413330    19369195    19608861    20068231    21269460    22814378    23902688    23186163    17344846    27762356    22293439    15652160    17381049    15592404    24402279    19468303    22992520    9022677    25157132    9766967    19892987    19393038    25069045    23594743    25329095   

EMBL

AY769969    AAV34694.1    BABH01042059    BABH01042060    BABH01042061    AGBW02012914    + More
OWR44218.1    AY526607    AAS92608.1    LMAW01002601    KQK79266.1    AAEX03003103    KL458139    KFV10696.1    KZ506593    PKU39030.1    KL672980    KFW87590.1    KL224757    KFW63300.1    AAMC01088905    AAMC01088906    AAMC01088907    KL205687    KFV72931.1    GFFV01003423    JAV36522.1    AAKN02010056    AAKN02010057    AABR07032254    BC127486    CH473971    AAI27487.1    EDM14608.1    CABD030041657    CABD030041658    ACTA01112662    ACTA01120662    ACTA01128662    AEMK02000012    DQIR01232641    HDB88118.1    AJFE02102412    AJFE02102413    AJFE02102414    AJFE02102415    AANG04003171    NDHI03003371    PNJ77433.1    AMGL01093478    AMGL01093479    AACZ04059121    GABC01007021    GABC01007019    GABF01003783    GABD01004071    GABD01004069    GABE01002888    GABE01002886    GABE01002885    NBAG03000228    JAA04317.1    JAA18362.1    JAA29029.1    JAA41851.1    PNI71886.1    JU320105    JU471767    JU471769    AFE63861.1    AFH28573.1    GAMT01008042    GAMS01005824    GAMR01006369    GAMQ01004352    GAMP01007227    JAB03819.1    JAB17312.1    JAB27563.1    JAB37499.1    JAB45528.1    KY609800    ASO76494.1    AK076070    AK078398    AK146873    BC002171    BC048081    X90945    X80693    L37042    AF218004    AK294942    CR542206    BT019829    BT019830    DQ082865    AC021078    CH471062    BC008717    CM004470    OCT88589.1    AKHW03006437    KYO20160.1    AB120744    BAC87883.1    KL447276    KFO71726.1    AGCU01195953    AGCU01195954    AGCU01195955    AGCU01195956    LSYS01001584    OPJ87928.1    AADN04000516    KK502338    KFP22803.1    JW866934    AFO99451.1    AC153155    KN122228    KFO31998.1    AQIA01060905    AQIA01060906    AHZZ02030191    AHZZ02030192    JH818550    EKC29796.1    UYYF01000189    VDM96908.1    EU668329    ACF94482.1    Y08817    BC057701    U80822    U80823    AF042863    RJVU01036043    ROL47054.1    KK453186    KFQ74834.1    KK716842    KFQ36986.1    BC043956    CM004471    AAH43956.1    OCT87739.1    AGTP01032782    AGTP01032783    AGTP01032784    AGTP01032785    ADFV01033730    ADFV01033731    ADFV01033732    ADFV01033733    ADFV01033734    BC109558    AAI09559.1    BX088707   

Proteomes

UP000005204    UP000007151    UP000051836    UP000007635    UP000002254    UP000053258    + More
UP000054081    UP000008143    UP000053584    UP000005447    UP000002494    UP000233120    UP000001519    UP000008912    UP000252040    UP000008227    UP000007646    UP000248480    UP000245320    UP000286641    UP000265300    UP000240080    UP000233020    UP000248481    UP000011712    UP000248482    UP000286640    UP000002356    UP000079721    UP000248483    UP000233040    UP000261681    UP000233220    UP000002277    UP000008225    UP000000589    UP000005640    UP000186698    UP000050525    UP000053760    UP000007267    UP000190648    UP000000539    UP000053119    UP000087266    UP000189705    UP000189706    UP000028990    UP000261680    UP000233100    UP000028761    UP000233060    UP000233080    UP000005408    UP000046394    UP000276776    UP000261440    UP000005215    UP000001073    UP000233140    UP000002281    UP000009136    UP000265140    UP000000437    UP000018467   

PRIDE

Q5UAE4    H9JXF4    F2Z4Z4    Q8BK63    P48729    E9Q4G7    + More
V9HW00    P67962    H7BXB1   

Pfam

PF00069   Pkinase

Interpro

IPR011009   Kinase-like_dom_sf        + More
IPR008271   Ser/Thr_kinase_AS       
IPR017441   Protein_kinase_ATP_BS       
IPR000719   Prot_kinase_dom       

SUPFAM

SSF56112   SSF56112       

ProteinModelPortal

Q5UAE4   H9JXF4   A0A212ERU7   Q699T5   A0A0Q3URS7   G3Q7M8   + More
F1PUU1   A0A093E8A4   A0A2I0TYY2   A0A093QMH7   G3Q7M6   A0A093NMT1   F6VPH2   A0A093GU85   A0A250XYR2   A0A286XXZ0   A0JPL2   A0A2K6CPS4   A0A2I2ZQU5   G1LFH9   A0A341AVQ2   F2Z4Z4   G3SQD7   A0A2Y9E0S3   A0A2U4AH10   A0A3Q7Q467   A0A340WKC9   A0A2R9C4S3   A0A2K5CCQ0   A0A2Y9FWD0   A0A2Y9HXL4   M3X447   A0A2J8X5Y1   A0A2Y9IS74   A0A2Y9INB2   A0A3Q7UAZ9   W5P5Y5   A0A1S2ZAL5   A0A2Y9PR04   A0A2K5SAB1   A0A384AMZ3   A0A2K6TCH3   H2R587   H9YY07   F7HFL4   A0A222AJF6   Q8BK63   P48729   A0A1L8GXP6   A0A151M6U2   Q75WS8   A0A091FRX0   K7G084   A0A1V4KU22   F1NNY1   A0A091JS33   A0A1S3SV14   V9KMH2   A0A3Q0GE16   E9Q4G7   A0A3Q0CXR0   A0A091DND5   A0A384C8F1   A0A2K5UUJ4   A0A2I3MX56   A0A2K5M6U3   A0A2K5JNP4   K1R720   A0A0N5CMR3   V9HW00   P67963   P67962   A0A3N0YLL8   A0A091TIY5   A0A3B4D197   A0A091RBV9   Q7ZY65   A0A287CT17   A0A2K6CPL3   A0A2K5UUD5   A0A2I3GM73   A0A2K5YKE8   A0A3Q2L8N3   A0A2U4AH82   A0A340WKL1   A0A096MQA6   A0A2Y9HXL9   A0A2K5M6T4   A0A2Y9IKQ1   A0A1S2ZAM0   A0A2K5JNJ1   Q32LI4   A0A3P8YCA6   A0A2R8QUQ3   W5K498   A0A1S3RTF0   A0A1S3RV14   H7BXB1   G3SIN1   A0A2R9C7U0  

PDB

5FQD     E-value=3.33615e-154,     Score=1397

KEGG

692729    K08957 casein kinase 1, alpha [EC:2.7.11.1] | (RefSeq) CKIalpha, Csnk1a1l; casein kinase I alpha

PATHWAY

04310    Wnt signaling pathway - Bombyx mori (domestic silkworm)
04341    Hedgehog signaling pathway - fly - Bombyx mori (domestic silkworm)

GO

GO:0005524   GO:0004674   GO:0007507   GO:0005737   GO:0005634   GO:0018105   GO:0090090   GO:0032436   GO:0016055   GO:0018107   GO:0045104   GO:0036064   GO:0007030   GO:1904424   GO:0005829   GO:0005847   GO:0030877   GO:0005813   GO:0000902   GO:1990904   GO:0045095   GO:0016607   GO:0004672   GO:0042277   GO:0051301   GO:0007049   GO:0000777   GO:0005929   GO:0051219   GO:0000287   GO:0006468   GO:0016020   GO:0007166   GO:1904885   GO:0007165   GO:1904886   GO:0016301   GO:0000139   GO:0008270   GO:0005215   GO:0006270   GO:0042555   GO:0003707   GO:0006281   GO:0006259  

Subcellular location

Cytoplasm   Localizes to the centrosome in interphase cells, and to kinetochore fibers during mitosis. Also recruited to the keratin cytoskeleton.   With evidence from 2 publications.
Cytoskeleton   Localizes to the centrosome in interphase cells, and to kinetochore fibers during mitosis. Also recruited to the keratin cytoskeleton.   With evidence from 2 publications.
Microtubule organizing center   Localizes to the centrosome in interphase cells, and to kinetochore fibers during mitosis. Also recruited to the keratin cytoskeleton.   With evidence from 2 publications.
Centrosome   Localizes to the centrosome in interphase cells, and to kinetochore fibers during mitosis. Also recruited to the keratin cytoskeleton.   With evidence from 2 publications.
Chromosome   Localizes to the centrosome in interphase cells, and to kinetochore fibers during mitosis. Also recruited to the keratin cytoskeleton.   With evidence from 2 publications.
Centromere   Localizes to the centrosome in interphase cells, and to kinetochore fibers during mitosis. Also recruited to the keratin cytoskeleton.   With evidence from 2 publications.
Kinetochore   Localizes to the centrosome in interphase cells, and to kinetochore fibers during mitosis. Also recruited to the keratin cytoskeleton.   With evidence from 2 publications.
Nucleus speckle   Localizes to the centrosome in interphase cells, and to kinetochore fibers during mitosis. Also recruited to the keratin cytoskeleton.   With evidence from 2 publications.
Cilium basal body   Localizes to the centrosome in interphase cells, and to kinetochore fibers during mitosis. Also recruited to the keratin cytoskeleton.   With evidence from 2 publications.

Length:

369

Number of predicted TMHs:

0

Exp number of AAs in TMHs:

0.02915

Exp number, first 60 AAs:

0.01692

Total prob of N-in:

0.01853

outside

1  -  369

 

 

Pi

238.404351

Theta

178.895105

Tajima's D

0.850758

CLR

0.124108

CSRT

0.619619019049048

Interpretation

Uncertain