SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15759
Pre Gene Modal
BGIBMGA002240
Annotation
PREDICTED:_uncharacterized_protein_LOC106134183_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 2.911
 

Sequence

CDS
ATGATTAAGTCAACGGTTACTAAAACTGAATTGGAGCAATTACAATTTAATGCCGAAAGTCTATACGAGACAACTGAAGAGATATACCTAGAATTTAAGGGATTATTAAAGGATTATTTTTTGGAATTTTCGAAAGGTCAAGGTCAACCACAATCATATAATACTACGCAGAGTTTTTTAGCAACAAGTGATGGTGAGACCACCCCGATTAGAACTAAATTACCTCCTTTATCGATTCCAAAGTTCGCCGGTAATTATAACGACTGGACAAGTTTTAAAGATTTGTTTAAGGCTCTCGTACATGACAACGTGCATCTAACAACGATTGAAAAACATCATTATTTAAAAACGAGTTTATCGGGAGAGGCTGAACAACTTCTAAAACATTTTGCACTCACGGAGGCTAATTACGATAAGGCTTGGAGTACACTTGAGAGTAGATACAATAACAAACGTATGATTGTCACTACAATAATTAGTCGCCTTTTAAATCAAAAGAAGATGAACATAGAATGTTTTAAAAGCTTAAAGGAAATTTTAGATACTACGAAGGAATGTTTGAATTCTCTTGACAATATCGGCGTGGATACCTCCACATGGGATGCAATTATCGTTCATTTAGTTGTATCCAAATTGGACTTAGAAACACACAAACAATGGGAACAGTCACTTGGATCATCTCAAGACATACCCACATTTACCATTTTATCATTATTTTTAGAAAATCGTTTCCGTTCTATGGAGATGGTAAATGTTACCCACAAAAAAGACCAACCGCAGAAAAAAGACTTAACTAAAAATTATACAACCCAAAAACCCACAAATATGAAGTCATTTGTCACAGAAGTAAGCAGCAAATGCACTTATTGTTCACAAAACCATTATATTTGTCACTGTAAAGAATTCACCGCATTAGATGTTCCTCAACGTCAGGATTTTATTAAGAAGAATGGCATTTGTTTTAATTGCCTTGTAAAGGGTCACTCCGTTAATGCGTGTAGGCAGAGCACCACCTGTAGAAAATGTTGTCGACGACATCACACTCTGTTGCACTTCACAAACCCTAACAAGACCACAGCAGTGCCGGAAAGCGATGCAGCAACACCCAGTACACCTGAAACAAGCCAAACCACATCAACCGTCGTTTACAAGGCTGAGGTTGACAAAAACAGTGAGGAAGTACTATTGGCAACCGCACGAATTGCAGTTAAGTCGAGGAACGGCGACACGATAGTCTTGAGAGCACTGATTGATCCGTGCTCGCAATCAAACTTTGTTACTGAAGCGGCAGCTCAACTGCTTAATCTCGAGCGCACTTCAATCAGCGGAAAAATTACTGGCATATCATCTATACCGCTGACCACCAAGTCACAAGTTACGTTGAACTTTCATGCTATAAGAAATTCATCACACATGATCACAGCTAAGGCGTACGTCCTTAGACGAATAAATTCGAGATTACCATCACAAGAGCTCCCATCAGATACCTGGCCTTCTTCTGAGATTTCGGATCTTGCGGATCCACACTTTCACAAGCCAGGATCTATCGACGTGCTATTAGGTGCAGTTGTATATGCGCATATTATTCTTGACGGAATAATAAAACGCAATGAGTCTCTGGTCGCTTTGAACTCAAGATTGGGATGGCTGGTAAGCGGCGAAGTTGCGCAGTCTGGCCATCAGTCACACAATGTAGTTGTTATGCACACACAAGTCGAAGTTGATCAGTTGCTACGTCAATTTTGGGAGATTGATGAATATTCACCAAACGTGAAGCCTCTGTCAAAACTTGAAATACAGTGTGAAGAGCATTTTAAGAAAACTCACACTCGAAACACTGACGGTCGATATGAGGTTCGCCTACCCTTCAAGGACGAAGACGCTCCAAGTTTAGGCAACTCCAGACAACTTGCTTTGAAACGCTTACATCAGATGGAGAATAAGTTTAAGCGAAGACCCGAGTTTCACGAAGAATACAGCAAGTTCATGAGACAATATGAGTCACTCGGTCACATGGAGGTCGTCCCTGAAACAGAGAAGATGAATAGAGCTTATTACCTACCACATCATGCTGTTCTTCGTGCCTCGAGCCTCACTACAAAGTTGCGCGTAGTATTTGACGGAAGCGCTAAGCCTGTAGACGGAAACTCACTTAACGATGAGTTACTCATCGGCCCACCGCTGCAACAAGATATACGAGATTTAGTAACACGGTGGAGACAACATAAGTACTGCCTAGTAGCTGATATACAACACATGTACCGACAGATACTTATTTCAAAGCAAGACACTGATTACCAGAGAATCTTGTGGCGCGAGTCATCGGAAGAACCGATTAGAGAATATCGGTTACTTACCGTCACATATGGCAGTTCATGTGCTCCATATCTTGCTATAAGGACACTTCATCAACTTGCAGAGGACGAACGTGGAGAGTTTCCTGAAGCTGAACTTCTAAAAACTGATCTCTATATGGACGATTTGATGACAGGCTCATCTACAGAAGAAGACACTCAACGGCTTCAACGTCGCTTAACTGAACTGTTTAAACGTGGCGGTTTTCTTCTACACAAGTGGTCGTCTAATAGTGAAATAGTTTTAAATGAGATTCCCGATTCGATAAAAACATTAAAAGGTTCAGTGAATATTAAAATGGATGATTCGGTGAAAGCTCTGGGCATAGCCTGGAAACCTCAAAGTGATATATTTGAACTGGTAGTTAACTTACCTCATGACAATGACGTTGTTACAAAACGAAGTGTGCTATCTGCGATAGCAAAAACGTTTGACCCTCTGGGTTGGCTAGCACCTTGCGTGATTGTGTTAAAAATGTTTATGCAGAAGTTGTGGCTGGCCGGCCTGGACTGGGACTCTGAACTTCCTGAAGACTTGAAAACTGAATGGCAGAATTACCTGACTAATTTTGAACACATGCAGGCCATTCAGCTTCCACGTTGGCTAGGGATTGCAAATAATGTCAAAATTGAATTGCACGGCTACTGTGACGCCTCTTGCGCCGCCTACGCTGCGGTTATTTACATCAGAGTCATCACGGACAATGAGATAAAAGTAAGTCTAGTCGCAGCCAAAACAAAGGTCGCTCCCGTTAAACAGATCTCATTGCCACGTCTTGAACTTTGTGGGGCAGTCTTATTGTCTAAATTGATACCATATGTCAAATCTAGTCTAAATATTGATGATAATTGTGTATTTGCTTGGACAGATTCCACAATAGTTTTGGCTTGGTTGCGTAAAACTCCAAATACTTGGAAGCCATTCGTTGGTAATCGCACTACCGAAATCTTGAATGTTACGAATAGTAGTCAATGGCATCATATTAAGTCTGCGGATAATCCCGCGGACTGCGCTTCACGCGGTATCAGTCCTGGCGAGCTGATGCAGTCACAACTATGGTGGGAAGGTCCAGCCTTTCTTCGCGAGTCTGTTGAGATTCGTTACCCTGATTTCACTATACCTGAAACCACACTCGAAGCAAAACCGAAAGCAAAAGTTAGTTATTTATGCACCTCTGAACCCAATGAATGTACTATGTACCTCAATAGATACTCAAATCTACTTAGACTTATACGTGTGACAGCCTATTGCTTTCGATTTTTGCGGCTATGTAAAGATAAGGCTCTCAAAAGGAACGATAACATAAAACTGACATACCTCACTACTGATGAAATAAAAAATGCATTAAAAACTTGCATACGAATGTCACAGTCTGTTTACTTTAAAAGTGAAATAGGATTGTTATCACAGAGCAAACCTATCCCAAAAAATAGTAAACTTTTACCTTTGAATCCGATCCTAGACAATGAGAAAATTATTAGAGTCGGTGGACGTCTTGTAAATGCTCAAATACCACCTGATATGAAGTCTCCTATAATCTTACATCACAAATGTAACTTAGCGAAGTTGATTGTAATTGATGCTCATTTGAGAACACTACATGGTAGAAATTCGCTCACATTAAATGTTGTCCACCAAAAATATTGGATTCTCCGAGCAAAGAACTTAGTAAAAAAGATTTTAAGATTATGTAAACCTTGTTTTACCCAAACTGCACGACCTATGACTCCGTTAATGGGTAATTTACCACAGTGCAGAGTTAATCCGTCACGCCCGTTTTTGACCAGCGGCGTAGACTTTTGTGGTCCATTTACGCTGAAACTGTACTCTGGTAGATGCACCAAAACTTGTAAAGCTTACATAAGTGTGTTTTTATGTATGGTTACAAAGGCTATTCACCTTGAGCTGGTTAGTTCACTATCCAGTGCTGCGTTTTTAGCAGCCTTTAAACGTTTTACTTCCCGACGTGGGCATTGTAAAGACATCTGGAGTGATTGTGGGACTAACTTCATAGGCGCGTCCAAAGAATTGGATCTCGCCTTCAAAAACAGTAAATCCACTGTCGTTGAAGAAATCGCCCAACTGTTAGCTAACGACAGCACAACATGGCATTTCATTCCCCCTGGTGCCCCTCACTTTGGAGGATTGTGGGAGGCAGGAGTTAAGTCCGTAAAAGGACATCTGAAACGTGTCGTAGGCGAGTCCTGCTTAACATTCGAAGAGTTTTGCACTCTGACCACACAGGTCGAGGCTTGTGTCAACTCTCGGCCTCTTACGTTGATTAGTTCTGTCGTTGATGAACTCCCGTTGACTCCTGGTCATTTTTTGATCGGCGAAGCACCGGTTACTATCCCTGAAGAAAGTTTCGTGGATACTCGACCTGACTATTTAAACCGATGGCAAAGGGTGCAACGTATGGTACAAAGTCTGTGGCGACGCTGGCAATCTGAGTATATTACTATGTTGCAACATCGATACAAATGGTCCCAGAATCACCCCGACATAAATGTTGGTACGGTTGTCTTAGTGAAAGATGATCGTTTACCTCCAGGTAAATGGCTTTTGGGACGAATCGTGGCGAAGCACCCGGGAGCAGACGGTGTAACGCGTGTAGTCTCCTTACAATTTAAGGATCGTGTATTTAAGAGACCAGTTACTAAACTGTGCCCTCTGCCTCTAGCTGCTTCAGAGCCTTAG
Protein
MIKSTVTKTELEQLQFNAESLYETTEEIYLEFKGLLKDYFLEFSKGQGQPQSYNTTQSFLATSDGETTPIRTKLPPLSIPKFAGNYNDWTSFKDLFKALVHDNVHLTTIEKHHYLKTSLSGEAEQLLKHFALTEANYDKAWSTLESRYNNKRMIVTTIISRLLNQKKMNIECFKSLKEILDTTKECLNSLDNIGVDTSTWDAIIVHLVVSKLDLETHKQWEQSLGSSQDIPTFTILSLFLENRFRSMEMVNVTHKKDQPQKKDLTKNYTTQKPTNMKSFVTEVSSKCTYCSQNHYICHCKEFTALDVPQRQDFIKKNGICFNCLVKGHSVNACRQSTTCRKCCRRHHTLLHFTNPNKTTAVPESDAATPSTPETSQTTSTVVYKAEVDKNSEEVLLATARIAVKSRNGDTIVLRALIDPCSQSNFVTEAAAQLLNLERTSISGKITGISSIPLTTKSQVTLNFHAIRNSSHMITAKAYVLRRINSRLPSQELPSDTWPSSEISDLADPHFHKPGSIDVLLGAVVYAHIILDGIIKRNESLVALNSRLGWLVSGEVAQSGHQSHNVVVMHTQVEVDQLLRQFWEIDEYSPNVKPLSKLEIQCEEHFKKTHTRNTDGRYEVRLPFKDEDAPSLGNSRQLALKRLHQMENKFKRRPEFHEEYSKFMRQYESLGHMEVVPETEKMNRAYYLPHHAVLRASSLTTKLRVVFDGSAKPVDGNSLNDELLIGPPLQQDIRDLVTRWRQHKYCLVADIQHMYRQILISKQDTDYQRILWRESSEEPIREYRLLTVTYGSSCAPYLAIRTLHQLAEDERGEFPEAELLKTDLYMDDLMTGSSTEEDTQRLQRRLTELFKRGGFLLHKWSSNSEIVLNEIPDSIKTLKGSVNIKMDDSVKALGIAWKPQSDIFELVVNLPHDNDVVTKRSVLSAIAKTFDPLGWLAPCVIVLKMFMQKLWLAGLDWDSELPEDLKTEWQNYLTNFEHMQAIQLPRWLGIANNVKIELHGYCDASCAAYAAVIYIRVITDNEIKVSLVAAKTKVAPVKQISLPRLELCGAVLLSKLIPYVKSSLNIDDNCVFAWTDSTIVLAWLRKTPNTWKPFVGNRTTEILNVTNSSQWHHIKSADNPADCASRGISPGELMQSQLWWEGPAFLRESVEIRYPDFTIPETTLEAKPKAKVSYLCTSEPNECTMYLNRYSNLLRLIRVTAYCFRFLRLCKDKALKRNDNIKLTYLTTDEIKNALKTCIRMSQSVYFKSEIGLLSQSKPIPKNSKLLPLNPILDNEKIIRVGGRLVNAQIPPDMKSPIILHHKCNLAKLIVIDAHLRTLHGRNSLTLNVVHQKYWILRAKNLVKKILRLCKPCFTQTARPMTPLMGNLPQCRVNPSRPFLTSGVDFCGPFTLKLYSGRCTKTCKAYISVFLCMVTKAIHLELVSSLSSAAFLAAFKRFTSRRGHCKDIWSDCGTNFIGASKELDLAFKNSKSTVVEEIAQLLANDSTTWHFIPPGAPHFGGLWEAGVKSVKGHLKRVVGESCLTFEEFCTLTTQVEACVNSRPLTLISSVVDELPLTPGHFLIGEAPVTIPEESFVDTRPDYLNRWQRVQRMVQSLWRRWQSEYITMLQHRYKWSQNHPDINVGTVVLVKDDRLPPGKWLLGRIVAKHPGADGVTRVVSLQFKDRVFKRPVTKLCPLPLAASEP

Summary

EMBL
ODYU01008608    SOQ52337.1    KQ460036    KPJ18393.1    KQ458473    KPJ05885.1    + More
LBMM01007859    KMQ89359.1    GEZM01060254    JAV71154.1    LBMM01008464    KMQ88855.1    LBMM01009898    KMQ87805.1    LBMM01009746    KMQ87900.1    LBMM01010405    KMQ87487.1    LNIX01000002    OXA59522.1    LNIX01000007    OXA51795.1    LNIX01000016    OXA46198.1    LBMM01009551    KMQ88039.1    KK114194    KFM61875.1    LBMM01009964    KMQ87756.1    LBMM01010417    KMQ87475.1    NWSH01000070    PCG79985.1    LBMM01008324    KMQ88972.1    LBMM01009645    KMQ87967.1    OXA60848.1    LBMM01009688    KMQ87939.1    GAMC01003146    JAC03410.1    LNIX01000036    OXA39969.1    LBMM01006490    KMQ90572.1    GFTR01008874    JAW07552.1    OXA51382.1    LNIX01000003    OXA58579.1    LNIX01000001    OXA61293.1    LBMM01009888    KMQ87813.1    LNIX01000044    OXA38660.1    GBGD01000063    JAC88826.1    ABLF02022040    ABLF02056888    LNIX01000005    OXA54454.1    AY180917    AAN87269.1    ABLF02041590    ABLF02042806    ABLF02005684    GGMR01002340    MBY14959.1    GGMR01020322    MBY32941.1    ABLF02042264    LNIX01000018    OXA45284.1    LBMM01010986    KMQ87097.1    GGMR01018506    MBY31125.1    GGMS01010524    MBY79727.1    LNIX01000069    OXA36894.1    GBBI01004211    JAC14501.1    AJ487856    CAD32253.1    GEZM01066272    JAV68024.1    GEZM01012999    JAV92824.1    ABLF02008594    JXUM01113346    KQ565681    KXJ70776.1    GBBI01004140    JAC14572.1    GBBI01004139    JAC14573.1    ABLF02030854    ABLF02067347    KQ460211    KPJ16510.1    ABLF02039606    NWSH01001945    PCG69607.1    ABLF02035780    EF426679    ABP48078.1    ABLF02023723    GEHC01000864    JAV46781.1    CR954257    CAJ14165.1    ABLF02025193    GBBI01004032    JAC14680.1    ABLF02016109    ABLF02016113    GEHC01000870    JAV46775.1    ABLF02022912    ABLF02038819    ABLF02051942    ABLF02060282    GGMR01020500    MBY33119.1    LBMM01009202    KMQ88311.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    KQ460970    KPJ10166.1    ABLF02030698    ABLF02030705    ABLF02030709    GEHC01000865    JAV46780.1    ABLF02041863    LBMM01011283    KMQ86917.1    U23420    AAB03640.1    GGMR01000448    MBY13067.1    GGMR01010723    MBY23342.1    KQ458793    KPJ04955.1    KQ460500    KPJ14270.1    ABLF02023842    ABLF02028949    ABLF02058391    GGMR01015704    MBY28323.1    ABLF02009451    LNIX01000011    OXA48427.1    GEZM01018629    GEZM01018623    JAV90127.1    ABLF02018588    ABLF02018590    ABLF02042430    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    ABLF02015138    GGMR01013370    MBY25989.1    ABLF02054908    GGMS01006636    MBY75839.1    ABLF02041614    KQ459312    KPJ01687.1    GBRD01007977    JAG57844.1    LBMM01011516    KMQ86784.1    GEHC01000894    JAV46751.1    GGMS01006802    MBY76005.1    ABLF02036131    ABLF02041527    ABLF02064049   
Pfam
PF17921   Integrase_H2C2        + More
PF05585   DUF1758
PF03564   DUF1759
PF05380   Peptidase_A17
PF18701   DUF5641
PF00078   RVT_1
PF00665   rve
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
PF00230   MIP
PF12259   Baculo_F
PF02145   Rap_GAP
Interpro
IPR001584   Integrase_cat-core        + More
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001878   Znf_CCHC       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR005312   DUF1759       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR001995   Peptidase_A2_cat       
IPR041373   RT_RNaseH       
IPR001969   Aspartic_peptidase_AS       
IPR041577   RT_RNaseH_2       
IPR000425   MIP       
IPR023271   Aquaporin-like       
IPR022048   Envelope_fusion-like       
IPR000727   T_SNARE_dom       
IPR000331   Rap_GAP_dom       
IPR035974   Rap/Ran-GAP_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF81338   SSF81338       
SSF111347   SSF111347       

Ontologies

Topology

Length:
1683
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0967099999999998
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00009
outside
1  -  1683
 
 

Population Genetic Test Statistics

Pi
341.762627
Theta
190.980062
Tajima's D
2.413588
CLR
0.446551
CSRT
0.934203289835508
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号