SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15751
Pre Gene Modal
BGIBMGA014357
Annotation
gag-pol_polyprotein?_partial_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 3.65
 

Sequence

CDS
ATGGATTCTACAGTTTATGCAGCCAATGATGAAAAAATGAAAGCACAAGGATCAGGTACTGTCCATGGAATGTCATGCGATTTACAAAATACTTTATTTATACCAGACCTAGCACAAAACCTTTTGTCTGTAAATTGTATTACCAACAATGATGGTTCTGTTGTGTTCACAAAGAATAAAGTGGAGATTTACAAAAATTCAAAATTAATTTTAACCGGCAAAAAAGAAAATGGCTTATACAGGGTGAATTTAGAAAAAGAACTGAAAAATGAAAATAAATCCTTACTTACACAAGTAAACGGAACAGCATTGGAATGGCATGCAAAACTGGGACACCCGGGTAAATCAGTACTAGAAACATTAACAAAAGTGGCAGACGGCATTAATATACAAGGTCCAAAAGTATTACAAGAACAGTGTAAAATATGTGCTGAAGCAAAACAATCAAGACTACCATTTAATACTATCAGAACTCGTGCTGAAAGGTACCTACAAATAATACACACAGACATATGTGGTCCCTTTGAAGAAAAAACTTATGATGGATACAGGTATGTTTTAACAGTAATGGACGACTTCAGTCATTTTACAAAAATCTATTTACTTAAAAACAAGAGCGATGCAAAAGAAGAAATTAAAAATTATATTGAAGAAACGGAGCGAGAGAAAAATAGTAAAGTATCGACTATAAGATGCGACAATGGAGGTGAATATACAAGTAACGATTTTAAAGCATTTTGTCAACAAAAAGGCATAAAATTAGACTACACAGTACCCTACTCACCACAATTAAATGGAAAAGCTGAACGCCTAAACCGGACATTATTAGAAAAAACAAGAGCATTACTCTTTGATTCTAAATTGAACAAAGAAATGTGGGGTGAAGCAATATATTGTGCTACTTATATTTTAAACAGACTACCAAGTGATGCCCTGAAAAACAAAACACCATATGAAATGTGGGTTGGAAAAAAGCCTAATATATCTAATATGCAAAAGTTTGGTTCTACTGTCTATGCAAAACAGTTACATCCAAATGTAAAGAAACTGGATCCTAGAAGCAAGAAACTAATAATGATTGGATACACTAATAATGGGTACAGACTGTGGAATGACAAGGAGAGAAAAATAGAGATATCAAGGGACATAGTGATAGTAAAAAGTGAAACTGAACAAAAGAAAGAAAACTATAAGAAAATAAATAATAATAAAAGTGAAAATGATGAAAAAGAGACAGACCAGGAAGAAGAGACAACAGAAAACCAGGAAGAGACTATAGACAACCAGAAAGAGACAACAGAAAACCAGGAACAGATTATAGAAAAGCAGGAAGAGACAACAGAAGATACCAGAACAGAAGAAAATAAAAATAATGAGACTTTTGAAGATGTAGTATCAGAAACTGAATCAGAAGACACAGAAAGAGAAAGAAACAGACATAATGAAGAAGACGGTTACCTAAGAAGAAGCAAGAGAATTAGACACATACCAATACATTTAAGAGACTACAGTTTACTTACTTACAGAGAGGCTGTAACATCTAAAGAGGGAGAAAACTGGGAGAAGGCCATAAATTCGGAGAAGGAATCCCTGGAAATCAATAATACCTGGGAAATAGTAGACAAGAAAGAGGCAAAAGATAGTAAAATACTTACAAACAAATGGGTATTCCGCGTGAAAGATAATGGGACTTATAAAGCTAGACTTGTTGTACGAGGATTTGAACAAAACAGTATTGACTACAATGAAATATACAGTCCAGTTGTCAGTCAGTCAACTTTAAAATCTTTATTTGCACTTGCTGCTTCTAAAGACTATAACATGATGACATTTGATGTTAAGACTGCATTTTTATATGGAGAGCTGGAAGAAAATGTGTATATGAATATACCGGATGGTTATGAAAAACAACCTGGGAAAGTTTGTCGATTAAAGAAATCCTTATATGGACTAAAACAAGCTCCTATTACATGGAACAAAAGATTTACAAAAGCAATGTTAAAACTTGGTTTAAAAGCTACCAAAACAGATCAGTGTGTATTTACAAATGAAGATAATACAATAATAATAGCAATCTATGTAGATGATGGACTTGCTTTGGCTAAAGAAAAGCAAACATTAAAAAACATTTTAAACTGCCTAGAAAAGGAATTTGAAATAAAAGTATACAATGATCCTACTACTTTTATTGGATTTGAAGTCAAGAAGACTGAGAAAGGTATAACACTGAAACAAGAAAGCTACATTGGAAACTTATTAAAGAAATTCAGTATGGAAGATTCTAAACCTGTTAAGACTCCCTGTAACACAGAAAATAAAACAGAAACGCAAAACACAGATTCTATAAATTTTCCATATAGAGAACTGATTGGAGGACTTCTATATGTATCTACAAGAACAAGGCCAGACATAAGTCAAGCTGTAAATGAAGCAAGCAGAAAAATAGAAAACCCTACAAAAGATGATGTGATAGCTGCAAAGAAAATACTAAAATATTTAAATGGAACAAGACAGAAAGGAATCATGTACAAGAAAGGAGGAGATATTTCAAAACTAAATGCATACTTACAACCGGATTTGTGA
Protein
MDSTVYAANDEKMKAQGSGTVHGMSCDLQNTLFIPDLAQNLLSVNCITNNDGSVVFTKNKVEIYKNSKLILTGKKENGLYRVNLEKELKNENKSLLTQVNGTALEWHAKLGHPGKSVLETLTKVADGINIQGPKVLQEQCKICAEAKQSRLPFNTIRTRAERYLQIIHTDICGPFEEKTYDGYRYVLTVMDDFSHFTKIYLLKNKSDAKEEIKNYIEETEREKNSKVSTIRCDNGGEYTSNDFKAFCQQKGIKLDYTVPYSPQLNGKAERLNRTLLEKTRALLFDSKLNKEMWGEAIYCATYILNRLPSDALKNKTPYEMWVGKKPNISNMQKFGSTVYAKQLHPNVKKLDPRSKKLIMIGYTNNGYRLWNDKERKIEISRDIVIVKSETEQKKENYKKINNNKSENDEKETDQEEETTENQEETIDNQKETTENQEQIIEKQEETTEDTRTEENKNNETFEDVVSETESEDTERERNRHNEEDGYLRRSKRIRHIPIHLRDYSLLTYREAVTSKEGENWEKAINSEKESLEINNTWEIVDKKEAKDSKILTNKWVFRVKDNGTYKARLVVRGFEQNSIDYNEIYSPVVSQSTLKSLFALAASKDYNMMTFDVKTAFLYGELEENVYMNIPDGYEKQPGKVCRLKKSLYGLKQAPITWNKRFTKAMLKLGLKATKTDQCVFTNEDNTIIIAIYVDDGLALAKEKQTLKNILNCLEKEFEIKVYNDPTTFIGFEVKKTEKGITLKQESYIGNLLKKFSMEDSKPVKTPCNTENKTETQNTDSINFPYRELIGGLLYVSTRTRPDISQAVNEASRKIENPTKDDVIAAKKILKYLNGTRQKGIMYKKGGDISKLNAYLQPDL

Summary

Uniprot
ProteinModelPortal
PDB
5UOQ     E-value=1.3468e-08,     Score=145

Ontologies

Topology

Length:
860
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.000850000000000001
Exp number, first 60 AAs:
0.00067
Total prob of N-in:
0.00011
outside
1  -  860
 
 

Population Genetic Test Statistics

Pi
37.742429
Theta
36.9232
Tajima's D
0.470748
CLR
0
CSRT
0.515324233788311
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号