SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15740
Pre Gene Modal
BGIBMGA010159
Annotation
PREDICTED:_dynamin-like_120_kDa_protein?_mitochondrial_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.673
 

Sequence

CDS
ATGGCAGAACTCATTGAAATTCAATCCATGATTTATGACAACATTGTCAAACTTAGCATCAACATAAAAAAGGATAGTGCGGATAGAAAGACGGCTGATTATTTTAAGAGAAGGTTGAGTACTTTAGAGAGCTACTGGCAAGAATGCCAATTTAACCATGACCGTATACAAACCGAAATAAGTAAGACTCATCCTTATTTCATCGAACAACAGTATGAAAAAATATATCAAACGTATGAGGCAACCAAGAATATGATTAACGAGCAGTATCAGCGACTAGTAGAACAAGTAGGCATTCTTCAAGAAGGGGAGGAAGCTGGTGCCCGTTCCCGGACGCCAGCAGGAGCGAAGTCAAAACAAATAAATGAAGAAACAAGAACCAGTGGGCAAAGCCAACAGGTTGAACAAATGAAAAGAAGCCAAGGCACAAACAGTAAATTGGATGATTTCTTAAAAAGACAAAATGCTAATTTTAAAGCCTTTATACGAACAACATCAAACATAGACGTAGATTTGATTGCTGATAAATGGGAATTTGAAGACTCTTTAAAAACACTACACGAACGATGGGCTGCTATCGATAGCCTTCACTGGGAAATCGAATCCGAGATGGACGGAGAAAATGAAACATACGCCGCCATGTACGATAGATACGAGAAGAAATTTAATACTCTCAAGAAAACATTGAACACAAAGATGTGGTCGGTAGCTCATAGATCGAATGCTACTCCACAATTGGAAATACCTGTCTTCAGCGGAAATTATAATCAGTGGGTTTCTTTCAAAGATTTATTCACGGAAGCTGTTCACAACAATCCATCTCTATCTAACAGTCAAAAAATGCAACACCTGAAAACTCCGGTGTCAACTGAACAAAACATTGCGAAACAACGCATAACACGAAATGAGAATGTTTCAAAAACCTCTAATGCTTCGCTAAATGAGAGTTCAGAAGTTTTATTAGCTACTGCTTTGGTGAAGGTGAAAGCGGCTGATGGAACCTATTACAACATGCGAGCTTTGTTAGATCAAGGCTCGCAAATATCTTTGATAACTGAAGCAGCAGCCCAAACATTAGGATTAAAGCGTCAAAGATGCAAAGGGGTTATATTTGGTGTAGGCCAAAACGAAAACAGCTGCAAAGGAAAGGTAATCATAGAATGCTCCTCAATTAACAATGACTTCAATTTCAAACTAGAGGCACTCATTATGAACAATTTAATAAAAAGTTTACCAAACAAAACATTTTCTAAGCCAGCGTGGTCATATTTGAATAATATCAATTTAGCTGATCCCGAGTTTTACAAGAGTCGGCCAGTCGATCTACTGTTCGGTGCGGATATCTACGCTAACATTATTCTGGGAGGAGTGATTAAAGGAGAAACCTTACAACAACCCATGGCTCAACAATCACAGTTAGGATGGTTTTTATGCGGAAGTATTAAAACTTATCATTGTAATGTGGCTCTCAATAACGTGGAAGATATACATAAATTTTGGGAGGTGGAAGAAATCAACGAATCGACGAATATTTCCGGAGAAGATCAGGAATGTATCGACTTTTACTGCTCAACAACAAAACGCATTGAAAATGGTCGATATGAAGTGAGATTGCCTCTAAAGCAAGATTTAAAACATAATTTAGGAATGAAGGCATTCGAAAAGGCGACAACACATTTAGATAAATCATGCAAAGTCCTGGAAGATGGTCAGTGTAGCATAATAGTCGATCAATTGATCCACGAATACAAAGAATTAACTTACTATAATGAGCTACTTATGAATCAACATTTGAATGAGCACTACAGACAGCGTCGTGGTTTTATCAACGGTGTCGGATATCTTGCTAACTCTCTGTTCGGAGTATTAGATGAACATTTCGCAGAAAAATACTCGCAAGACATAGAGCTCGTAAAACATAATGAACAGTACTTAGTGAGTTTATGGAAAAACCAAACTTCGATCGTCGAATCTGAATACAACTTACTAAAAAGAACAGAAGAAGTCATGTCTAAGCAACATAAGACTATTAATAAACACATAACTAACCTAGAAAACATGTCAAATCGACTTCAACAGCAAGTAAACAACATATCGATTCTACAAGAATTTACCTTAATGTCCATTATTACAACTAATTTATTGCACAATTTGAAAGGGTCGCAAAATATATTCTTAGACATTTTAACTAACATACATCATGGTCAATTCAACATTCATTTACTTACTCCAGAACAACTTCAAAAGGAACTAAACATTATCACCGGATATTTACCGGAAGACACAATTCTTCCCGTAGAACCGCAGAATATTAAGAATTTGTATCCTCTATTAAACATAAAGGCTCGTATTACTCTACAATATTTCTTATTCGAGATAACATTTCCACTCATTTATCAAGATCGATTCAAACTTTATAAAGTACATTCTATTCCTCATCAAAGCGGAAATATGACTATTGAAGTAGTTCCGGCATACGAATACATTGCTACCGACTTGAAAAGAGATTCCTTTCTTGAACTCACCACCGAAGAAGTCTTATCCTGTAATCAACAAGAAGAAGCTTACTACTGCAAGCTTAGAACGCCGATTCTTCATTTACGACCGGAGACTAAGTTTTGTAAGATTAAACTTAATAGCAACGTATGCAAATTAAAGTATTCTAATTGTGAAACCAAAATAATAGCACTAACTCATCCCTCTTTATATTTATATCACTGCTGTGGCACCTGCGAAGTAAAGGTCATGTGCGGAGAACATATTGCCTTGAAACAGTTGAATAACACTGGTCGTCTGTATCTAGAGCCAGGTTGCCTCATAAAGGGATCAGATTATACACTTCATATCCCTAAAACAAACAACAATAAGCTGGAGATTCAGTCTAACATTTACGTTCCAATAATAGATCCCATAAATAATATCATAAACAGCTCTCTTCTCAACACTGAGAACCTGAATGTCAGCGAGTCTAAAGATTTGCAGAACGCTCTCCAGAAACTACACGTGCGTATTGAAGATCTAGAAAACTCCCCGCCAGTATTGGAGACTTCATTAACATCTCACGATATTCATCAGTATGTGATAACATACATCATCGTCATCGTCATCGTGCTGGCCACCGGCGTGCTACTCTGGCGACGACGACGGTTGAGTGCGAACCGGGCGATCATCTCTGACGGCATCGAGCTTCAACAGTATAGTGAATGTGAAAATGTAAATAGTGCTAAGGCAGGGTTTAGTGCGCGACCTTCTGTGGTGGACCCTTCGCCTGGTGATGTGAACATTTATGCCAAAGTGTCAAACAAAGCGTGCTCTCCAATACCAAGAAAACCTATATGGACCCTAAGTTCTTAA
Protein
MAELIEIQSMIYDNIVKLSINIKKDSADRKTADYFKRRLSTLESYWQECQFNHDRIQTEISKTHPYFIEQQYEKIYQTYEATKNMINEQYQRLVEQVGILQEGEEAGARSRTPAGAKSKQINEETRTSGQSQQVEQMKRSQGTNSKLDDFLKRQNANFKAFIRTTSNIDVDLIADKWEFEDSLKTLHERWAAIDSLHWEIESEMDGENETYAAMYDRYEKKFNTLKKTLNTKMWSVAHRSNATPQLEIPVFSGNYNQWVSFKDLFTEAVHNNPSLSNSQKMQHLKTPVSTEQNIAKQRITRNENVSKTSNASLNESSEVLLATALVKVKAADGTYYNMRALLDQGSQISLITEAAAQTLGLKRQRCKGVIFGVGQNENSCKGKVIIECSSINNDFNFKLEALIMNNLIKSLPNKTFSKPAWSYLNNINLADPEFYKSRPVDLLFGADIYANIILGGVIKGETLQQPMAQQSQLGWFLCGSIKTYHCNVALNNVEDIHKFWEVEEINESTNISGEDQECIDFYCSTTKRIENGRYEVRLPLKQDLKHNLGMKAFEKATTHLDKSCKVLEDGQCSIIVDQLIHEYKELTYYNELLMNQHLNEHYRQRRGFINGVGYLANSLFGVLDEHFAEKYSQDIELVKHNEQYLVSLWKNQTSIVESEYNLLKRTEEVMSKQHKTINKHITNLENMSNRLQQQVNNISILQEFTLMSIITTNLLHNLKGSQNIFLDILTNIHHGQFNIHLLTPEQLQKELNIITGYLPEDTILPVEPQNIKNLYPLLNIKARITLQYFLFEITFPLIYQDRFKLYKVHSIPHQSGNMTIEVVPAYEYIATDLKRDSFLELTTEEVLSCNQQEEAYYCKLRTPILHLRPETKFCKIKLNSNVCKLKYSNCETKIIALTHPSLYLYHCCGTCEVKVMCGEHIALKQLNNTGRLYLEPGCLIKGSDYTLHIPKTNNNKLEIQSNIYVPIIDPINNIINSSLLNTENLNVSESKDLQNALQKLHVRIEDLENSPPVLETSLTSHDIHQYVITYIIVIVIVLATGVLLWRRRRLSANRAIISDGIELQQYSECENVNSAKAGFSARPSVVDPSPGDVNIYAKVSNKACSPIPRKPIWTLSS

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
1117
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
21.59555
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1022
TMhelix
1023  -  1045
inside
1046  -  1117
 
 

Population Genetic Test Statistics

Pi
187.319863
Theta
155.265029
Tajima's D
0.500625
CLR
39.915057
CSRT
0.515024248787561
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号