SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15738
Annotation
Transposon_Ty3-I_Gag-Pol_polyprotein_[Operophtera_brumata]
Location in the cell
Cytoplasmic   Reliability : 2.429
 

Sequence

CDS
ATGGATTTACCTATCTTACAAGAGCTTCTGAAGGCCATCAAAGACGCAGTTTCCGGTTCCCGCCAGAACGACAGCGAGGTCGCCCTGCCCGTATTTGATCCTGCTAAAAGTGACCTTGGTGCTGAATCATGGTGCAACAATATTGAAACCCTCTCCAAAGAGTTTGGATGGAGTAACATCGCAACAGTCGCCAAAGCTGGTAAGGCCCTTAAGGGATCCGCCTTATTGTGGTTTGAAACATGGGACCCGGCTGAGGGTCGTTCGTGGGACAATTTACGTTTAGAGCTGGTAGCTTTATACCCTGAGAAAAAGAATCTAGCAGAAAAACTTCATAAGGCAGTACTATACACGTCGGAAACTGCAGATTCTTATTGCGAGTACGCAAGGGAAAAAATTAGTATAATGGAACTCTCAGGTGCGATAAACAGTCTAGATCATCAGCTGCAGGATAGGATAAGGGCTATTTTTCAAAAATACCCCTCTGTTTTGGACAATATTGGTCATGTAAAGACTGGTGAACTTGAAATAAAATTAAAAAGAGATGAGGTTGAGCGTTATGTGGCTACTGTAGTCAATATGTTAAACACTATGTGCGAGGAGCCGTCAGAGTGGCCGAACGTATTGCCAAAAGTACAGCAGTCAATTAACACGACAGTACAAAAATCGACTGGTTTCACCCCCTTACGTTTACTAACCGGTATAGAAGCAAATATACCTATAGTACAATCTCATCTAAACGGAATTATTAATGATGAGGATTTACACCCCAATATTGACGTCCAAGCTGATCGTGAAATAGCCAAACAGAGACTACAAAAAATAGCAGAAACATTTAAACAACGATTTGATCATGTTAGGCGGAATAATAAACAATACAATATAGGTGATTTGGTCTATGTCAGCCAAGATCATAGGCGTAATGATAAATTAAGATCTAGATTTAAGGGCCCTTACGAAATTCAGTCTATCCTTCCAAATGATCGCTATACTCTGAAAGGCAACGGTAATGTTAGGAATATAGTTGTCGCTAAGGAAAAATTACGGTTTTGGCCAGGAGAATGGGTTGATGATAATTTGTGA
Protein
MDLPILQELLKAIKDAVSGSRQNDSEVALPVFDPAKSDLGAESWCNNIETLSKEFGWSNIATVAKAGKALKGSALLWFETWDPAEGRSWDNLRLELVALYPEKKNLAEKLHKAVLYTSETADSYCEYAREKISIMELSGAINSLDHQLQDRIRAIFQKYPSVLDNIGHVKTGELEIKLKRDEVERYVATVVNMLNTMCEEPSEWPNVLPKVQQSINTTVQKSTGFTPLRLLTGIEANIPIVQSHLNGIINDEDLHPNIDVQADREIAKQRLQKIAETFKQRFDHVRRNNKQYNIGDLVYVSQDHRRNDKLRSRFKGPYEIQSILPNDRYTLKGNGNVRNIVVAKEKLRFWPGEWVDDNL

Summary

Uniprot
ProteinModelPortal
PDB
3DLR     E-value=0.00161235,     Score=98

Ontologies

Topology

Length:
359
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00095
outside
1  -  359
 
 

Population Genetic Test Statistics

Pi
183.183764
Theta
18.579367
Tajima's D
-0.342032
CLR
0.984303
CSRT
0.278686065696715
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号