SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15732
Annotation
ORF_B_(bases_1850-5560)_first_start_codon_at_2306_[Autographa_californica_nucleopolyhedrovirus]
Location in the cell
Nuclear   Reliability : 3.089
 

Sequence

CDS
ATGCAAGCATTTGTTCGAGGCCTCAAGGAACCCTTGGGATCTCGCATACGCTGCATGAGACCGACCTCCATTGAAAAGGCTCTGGAATTTGTACAGGAAGAACTTAACATAATGTATCTACAACAGCGAAACGGGTTCACCTCTGAACGGCGCAACCTTATTCAGCCTGCACCGACACCACCTGTAAAAATACCACCTATGTTTCCGGTAGCAATGCCGAAACCGCTTTCATTCGGACCGAACCCAGGACCGAGCTGGGAGCGACAGCCACCACCAGGACCTAATAACCACTGGAAACCTGCTTTCAAATTTAACGCCCCTCAGCGCATGCCTAACATGCCATCACGCACGCAGCAAATGTTCGCATCGCACCCACCAAACTACAACCCCCGTAGCAACGTATTTAGGCTACCTCAGCGGAACCAGGGACCGAAACCTATGAGTGGTATTAGTCACTACGTGGCAAAACAACTTCCACTCACAGGTCATGATTGGACTTTTTCAGAACTTAACGACGCGGGACCTATTAAACTGTTTGTCTACGATTTCCACAAATTTTTTGACGGACTTATTGGTTTAGACTTGCTGACTAAATGGAAATCTAGAATCGACCTTAAAGACAACCTACTGATTACAGACAATTCTACCAACCCTATTGAAATGTTCAATTCTCGCAACGTCAACCTGTACGAAGACATCGTACCGGCTAACTCTAGTAAACTAGTTAGAATTCCAATAAATTCATCTGACGGCGAAGTCTATATCCCGCAGCAATATCTGAACAACTGCGTGGTGAACGAATGCATCACGACAGTCGTTAAAAACCGTGTGGTCGGAGACATCAAAAAACGACCCGTTGTCAGTAAGCCATTTGAAACGCACACTCGCATATCCATACAAGTTTCCCAATCAAACTTAAGAGAAGACGTCATAAACGCCATTAAAGAATTCGTTAATCCTAAAGTAAAAACTGGCCTCCTTATTAATCCAACATTAAGCATGTACGACATTATACCTATAATACAGGACACGTTCAGAAATTCGGCAATGAATCTCTTACTCACAAAAGTCGAATTAGAAAATGTGAAGGAGTACCTTCGGCAACAAGAAATAATAAGCCACTATCACGATGGAAAAACTAACCACCGCGGAATAAACGAGTGTTATTTAGCTCTTTCGCGAAAATATTACTGGCCGAAAATGAAAGATCAAATTACAAAATTCATAAACGAATGTACTATATGCGGACAAGCTAAATACGATCGCGCACCCATTAAACAGCAGTTTAGCATAGTACCACCCCCGAAGAAACCCTTCGAAATAGTTCATATGGACTTGTTCACCGCCCAATCCGAAAAATACCTGACATTTATTGACGTATTCTCTAAGTACGGACAGGCTTACCTGTTGAGAGACGGCACAGCAATTAGCGTATTACAGGGTCTATTGCAGTTCTGCACGCATCATGGTCTACCTTTAACGATAGTAACTGATAATGGTACAGAATTCACAAACCAATTGTTTTCCGAATTCATACGACTTCACAAAATAAATCATCATAAAACCCTAGCACATACACCTAATGACAACGGCAATGTAGAGAGATTCCATTCAACCTTGCTAGAACACCTTCGCATACTTCGCTTACAACATAAAAATGAACCTGTAATAAACTTAATGCCTTATGCAATATTAGCTTACAACAGTTCAGTCCACAGTTTCACCAAATGTCGCCCTTTTGACATCATAACGGGACACTTTGACCCTAGAGACCCTCTCGACATTGACATAACAGCCCATTTACTGCAACAGTACATGGAATCACATAAAGCTCAAATGACTACAGTTTATGAACTCATAAATGAAACCTCACTTGCTAACCGTACATCGCTCATTGAAAATAGAAATAAGAACCGCGAACCAGAAGCGACGTACCAGCCTAACCAACAAGTTTTCATTAAAAACCCGATAGCAGCCCGACAAAAAACAGCCCCGAGGTACACTCAAGATAGAGTGCTAGCAGACTTACCAATTCATATCTACACATCGAAAAAACGAGGCCCTATTGCTAAATCTCGACTTAAACGTGCACATAAAGACTTCCGATTCCTCAAACCCAATCGTGTAAAAAGAGGTCTCATTGATGGCTTAGGTTCAATTGTTAAAAGCATTACAGGAAAGAAAATAGTTATTGTCTTTAAATTTCCTGTAATTTCTCCGGATGAATTCGAACTATATAAATTAACCATTGCCCCTAATAAGCATCAATTAACTTTCATCCCTCCTTATCCTTTCATCGCAACAAATAAGAAAGCGTTCATGTACATAGAGGCTGAATGCCCGAAGTACAACAGGTACTACCTCTGCGAGGAAAATATAAATCACCAGCCAAGAGATGATCCTGATTGCATCCACGATCTTATCTACAATCAAGCCATGAACACCTCATGCCAGCCAACCTCTGTTTCTTTCACTAAAGAAGCCATGGAACAACTAGACGATAAGCATTACGTCCTTATTTTCCCCGAGACCACGAAGATCGAACTTCATTGTCAACGCCTGGAGTACAGTACGCTTCAAGGAAGTTATCTCGTTACCATTCCGCAAAATTGTAAGCTGCGAACCGGACGACTAACACTGGCAAACAATAATGATCAGATCAACGGACAGCCTCTGAAAATAACTGAAATCCCGAAGGATGCAAAAATCACAGGACCCATTAGACCTCATATCAAGCTCACCTCCTTGAACCTGGAGAAAATACACCAAATCCAAGATGATATAATCCAACAACATCCTGTGGACCTAGAACAAAGTGACGTCACGAACCAAGCACTCTTTCATACGACAATACCTTTTTACGGAGCACTCTGCGGCGCGATTGTCCTAGCTGTTGTAATCGCTGTTCATCGGCACAAGTCTTGCAACATAACCCTGGAAAAGAAGCCACGCGAAGAAACCTCAAAATTTCACCCGTACGAGAGTCCAGAAGAACCCCAGAAGAAGGACCGAATTCCGGCAACATTTGCCCTCAAGATTATCAAATAG
Protein
MQAFVRGLKEPLGSRIRCMRPTSIEKALEFVQEELNIMYLQQRNGFTSERRNLIQPAPTPPVKIPPMFPVAMPKPLSFGPNPGPSWERQPPPGPNNHWKPAFKFNAPQRMPNMPSRTQQMFASHPPNYNPRSNVFRLPQRNQGPKPMSGISHYVAKQLPLTGHDWTFSELNDAGPIKLFVYDFHKFFDGLIGLDLLTKWKSRIDLKDNLLITDNSTNPIEMFNSRNVNLYEDIVPANSSKLVRIPINSSDGEVYIPQQYLNNCVVNECITTVVKNRVVGDIKKRPVVSKPFETHTRISIQVSQSNLREDVINAIKEFVNPKVKTGLLINPTLSMYDIIPIIQDTFRNSAMNLLLTKVELENVKEYLRQQEIISHYHDGKTNHRGINECYLALSRKYYWPKMKDQITKFINECTICGQAKYDRAPIKQQFSIVPPPKKPFEIVHMDLFTAQSEKYLTFIDVFSKYGQAYLLRDGTAISVLQGLLQFCTHHGLPLTIVTDNGTEFTNQLFSEFIRLHKINHHKTLAHTPNDNGNVERFHSTLLEHLRILRLQHKNEPVINLMPYAILAYNSSVHSFTKCRPFDIITGHFDPRDPLDIDITAHLLQQYMESHKAQMTTVYELINETSLANRTSLIENRNKNREPEATYQPNQQVFIKNPIAARQKTAPRYTQDRVLADLPIHIYTSKKRGPIAKSRLKRAHKDFRFLKPNRVKRGLIDGLGSIVKSITGKKIVIVFKFPVISPDEFELYKLTIAPNKHQLTFIPPYPFIATNKKAFMYIEAECPKYNRYYLCEENINHQPRDDPDCIHDLIYNQAMNTSCQPTSVSFTKEAMEQLDDKHYVLIFPETTKIELHCQRLEYSTLQGSYLVTIPQNCKLRTGRLTLANNNDQINGQPLKITEIPKDAKITGPIRPHIKLTSLNLEKIHQIQDDIIQQHPVDLEQSDVTNQALFHTTIPFYGALCGAIVLAVVIAVHRHKSCNITLEKKPREETSKFHPYESPEEPQKKDRIPATFALKIIK

Summary

Uniprot
ProteinModelPortal
PDB
3S3O     E-value=1.22576e-07,     Score=138

Ontologies

Topology

Length:
1015
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
21.03067
Exp number, first 60 AAs:
8e-05
Total prob of N-in:
0.00009
outside
1  -  946
TMhelix
947  -  969
inside
970  -  1015
 
 

Population Genetic Test Statistics

Pi
281.986337
Theta
195.260421
Tajima's D
2.898837
CLR
0
CSRT
0.975151242437878
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号