SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15730
Pre Gene Modal
BGIBMGA002257
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 2.704
 

Sequence

CDS
ATGCAATTTCTCAGTGATCCCTGCGCTAAGCTAGAATCTTTGTCAGCTGAGGTGCCAAGTACAGCTCGTAAAGGAAAGGGTAAAGAAAATCGAGTGTTAAACGACATTATTGCCATCTTTAAAACAGAACCTGATGCGTTGCCAGTGTTTGTGGCCCGAGATCTCAACAAGTTACCACCAATCACCTTCGATCACTTGGATGTTTCCAAACTACTAAAAGATCTCGTGCTGGTCCAAGCTGAAATTAAGGCCATTAAATCGTCGTACGTGACTCAGGATGAAATGCAAGACTTGAGGACAAAGTGTGACATGATCTCAATGTCTTCGACAAACATAAATACAAAGAGAGGTGCTTTTTGTAATAAAATTGACATGGAGTTTACGAGTCAAGAAAGTAATTCTGGTTGCGAGGAGCAAGTATTAATAAAAAACTTAAGCTCAAATTCTACAAATACCGAAAATCTAATAGAAGGTAGTGGCATAAAACTTCGACGGTATGAATTGAACGGTAGTGACAACAACTTATCGCACCACAACGTAGCGAGTAAAGGTAACGGGAACGACGAGTCATTGCTATCGTCCGTCGATCAGCTGAGTGAAAGGATTATAGTGCCGTCACTGATCGCACCGAGTCAATCGTATGCTAAAGTTGTAGCAGTACAAAATAACGATGGATTCACTTTGGTACAATCGAAGAAAAAACGTAACAATAAGTTTAAAGGCAGTGTAGGTAGTGTAGTAATAGAATCAAACGAGAAGTTTAGGTCCGCTGATCGAAAAACGCCTATGTTCATAACAAACGTAAACAAGGCAACATTAGAATCAGATATAAATGACTACATCTACAAGAAAACAGGAGAGAATGTGACCTTAGAACGTATCAACATCAAACGGCAATGTGAACACAATGCGTACAAGTTTATTGTGTCCCAAAGAAAGCTGCATATGTTTATGGATGATAAGTTATGGCCTGAGGGAATTATTTTCCGACGATTTGTACATTACAGACCGAAACGTAATAACGAGACTGTGTACATGCCAACAGACATTGCGGCAAATCTTACGGATTTTACGGATATCCTGAGTGTGGTGAGTGCCATTATTGAGAGCTGTCATATTGACCATGTTTTTATGTTGGGTGATTTTAATGCACATCCTTCCGAACAATTTTATGATGAGTTATCTGTATATTGTGATGAACAAAAATGGATATGTATAGATACTAAATTATTAGGAATACGATCTAACACGTATACTTTCTTAAGCGAGGCTCATATGTCAAAGAGGTGGCTTGATCATTGCGTGGTTACCGAAGCTGCTGTGAGCTTGGTTGAGAATGTATACGTGTTGTATGACGTGTTATGGTCCGATCACTATCCTTTGATAGTTGAATGTAGGTTAGATAAAATAACTGCAAAAAGACTTGATGTTTGTTTAAGTAAATCCAATAACGTTATTTGGGGTGAGAGAAGTCCTGATCAAATAGAATCTTATCAGAAAGAATGTAATAAAAGATTAAGATTAATTGACTTTCCTCATGAACTCAGTAAATGCTGTGATGGTGTGTGTACTGAAGTAAATCACATAGTAGTTATAGATAAATTGTATACAGATATTGTAAATGCCCTAAGTGCAGCTGCATTGGACGGTCGGGAGGGCGCTGTAAAACGTGCTAGAAGAGTGGTAGTGGGCTGGAATAAGCATGTTGCCGAGGCTCACAGGGAAGCTAGGCAAAAGTTTTTGTTGTGGGTAGGGTACGGTAAACCTACTTCTGGGTATGTGTATAATGATATGTGTGAATCTAGAAAAGTTTTCAAGTCTAGACTAAAGTGGTGCCAAGATCATGAGGACCAAATAAAAATGGATATTCTAGCCTCACACCATTCTAAAAGTGATTTTCGTGGCTTTTGGAAACACACAAATAAATTAAAGAATAGGCCGACAATACCTGTGAGCGTCGGTGGCGTGAGTGAACCAGAACAAATTGCCAACATGTTCAAGGAACGCTTCTTTGTAAAATCTACTTTAGGACTCGCTGGGTCGGTGCTTGATATTGAGCACGGCAGGGAAATTGGAGTGGCATTTACGTCTAAGGATGTTAAAAAGACAATTAGGTCAATGTCACGTGGTAAGTCTCCGGGACATGACGGGCTCAGCATTGAGCACCTGCGTTATGCGGGCGTGCACATCTCTAGGGTTCTCTCAATGCTGTATAACATTTGTGTGGGTCATAGTTATTTGCCAAGGGAAATGATACGAACAGTAGTTGTACCAATAGCTAAAAATAAGACTGGAGACCTTGCAGATAGCAGTAACTATAGGCCTATCTCACTAGCTACTATTATATCCAAAGTGTTGGACAGCATGCTTAACTTTAAACTAAATAAATATGTAAATCTTCATGATAACCAATTCGGATTCCGTTCAGGTTTGTCGACAGAGAGTGCAATCTTAAGTCTTAAGCATGCTGTCAAATACTACACGCGGCGAGGAACACCTGTTTATGCCTGCTTTCTTGATCTGTCCAAGGCGTTTGATTTGGTTTCCTATGACCTCTTGTGGAAAAAGTTGGAAAATATTAAACTACCCACGGAAATAAATAACATTCTAAAGTTTTGGTATGGGAACCAGATCAACAATGTGCGATGGGCTGGGGCTTTGTCTCTTCCATATAGGTTGGAGTGCGGGGTGAGACAAGGCGGGTTGAGTTCGCCTACGCTCTTCAACCTGTATATAAACGAGCTGATCGGCGAGCTCAGTAGGACCAGGATTGGTTGTTTCATAGACGGGGTGTGCGTAAACAACATCAGCTACGCAGACGATATGGTGCTGCTGAGCGCGTCTATCTGTGGCCTAAGGCAACTTGTTTCTTTGTGTGAGGGATACGCCAAATCACACGGTTTGGTGTACAACTGTAAAAAGTCGGAGATCATGGTCTTTGAGACCAGGGGTGGGACGCATGATAAAATACCTCCCGTAGTACTCAACGGAACGCCATTGACAAGAGTTTATAAATTTAAATATCTCGGCCATGTGTTGACCCCTGATCTCAAAGATGATGAAGATATTGAACGAGAGCGGAGAGCGTTGTCGGTTAGAGCAAACATGATAGCTCGCAGGTTTGCACGGTGTTCACTTAAAGTCAAGGTCACCCTCTTTAGGGCCTACTGTACTAACTTTTACACGTGCAGCTTGTGGGCTGGATATACTCAAAGATCGTACAATGCTCTCCGTGTTCAATACAATAACGCGTTTAGGGTGCTGGTGGTGCTGCCCCGCTTTTGTAGCGCATCAGGGATGTTTGCAGACGCGCACATAGATTGTTTTTACGCTACCATGCGTAAGAGGTGTGCATCTCTGGTAAACAGAGTGAGGGCCAGCTCCAACAGTATCCTGAGCATGATCGCAAGCAGGCTGGACTGTATATACATGGGTCGCTGTGGTGCCATCTCCCATGGGATGTTACCACAGTAA
Protein
MQFLSDPCAKLESLSAEVPSTARKGKGKENRVLNDIIAIFKTEPDALPVFVARDLNKLPPITFDHLDVSKLLKDLVLVQAEIKAIKSSYVTQDEMQDLRTKCDMISMSSTNINTKRGAFCNKIDMEFTSQESNSGCEEQVLIKNLSSNSTNTENLIEGSGIKLRRYELNGSDNNLSHHNVASKGNGNDESLLSSVDQLSERIIVPSLIAPSQSYAKVVAVQNNDGFTLVQSKKKRNNKFKGSVGSVVIESNEKFRSADRKTPMFITNVNKATLESDINDYIYKKTGENVTLERINIKRQCEHNAYKFIVSQRKLHMFMDDKLWPEGIIFRRFVHYRPKRNNETVYMPTDIAANLTDFTDILSVVSAIIESCHIDHVFMLGDFNAHPSEQFYDELSVYCDEQKWICIDTKLLGIRSNTYTFLSEAHMSKRWLDHCVVTEAAVSLVENVYVLYDVLWSDHYPLIVECRLDKITAKRLDVCLSKSNNVIWGERSPDQIESYQKECNKRLRLIDFPHELSKCCDGVCTEVNHIVVIDKLYTDIVNALSAAALDGREGAVKRARRVVVGWNKHVAEAHREARQKFLLWVGYGKPTSGYVYNDMCESRKVFKSRLKWCQDHEDQIKMDILASHHSKSDFRGFWKHTNKLKNRPTIPVSVGGVSEPEQIANMFKERFFVKSTLGLAGSVLDIEHGREIGVAFTSKDVKKTIRSMSRGKSPGHDGLSIEHLRYAGVHISRVLSMLYNICVGHSYLPREMIRTVVVPIAKNKTGDLADSSNYRPISLATIISKVLDSMLNFKLNKYVNLHDNQFGFRSGLSTESAILSLKHAVKYYTRRGTPVYACFLDLSKAFDLVSYDLLWKKLENIKLPTEINNILKFWYGNQINNVRWAGALSLPYRLECGVRQGGLSSPTLFNLYINELIGELSRTRIGCFIDGVCVNNISYADDMVLLSASICGLRQLVSLCEGYAKSHGLVYNCKKSEIMVFETRGGTHDKIPPVVLNGTPLTRVYKFKYLGHVLTPDLKDDEDIERERRALSVRANMIARRFARCSLKVKVTLFRAYCTNFYTCSLWAGYTQRSYNALRVQYNNAFRVLVVLPRFCSASGMFADAHIDCFYATMRKRCASLVNRVRASSNSILSMIASRLDCIYMGRCGAISHGMLPQ

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF12832   MFS_1_like
Interpro
IPR024989   MFS_assoc_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036259   MFS_trans_sf       
IPR000477   RT_dom       
IPR020846   MFS_dom       
SUPFAM
SSF103473   SSF103473        + More
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=3.739e-05,     Score=117

Ontologies

Topology

Length:
1157
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.51651
Exp number, first 60 AAs:
0.00066
Total prob of N-in:
0.00005
outside
1  -  1157
 
 

Population Genetic Test Statistics

Pi
235.200618
Theta
206.634236
Tajima's D
1.387694
CLR
137.694773
CSRT
0.765811709414529
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号