SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15725
Annotation
PREDICTED:_serine/arginine_repetitive_matrix_protein_1-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.194
 

Sequence

CDS
ATGATGGCAAACTTACAAAAAACATTACCCCAGGAGGGTACCACTCTAGGTGGAGAATCCCTCCGTGCTTCCACTTCGGTGGGAGCATGCTGCCCCACGTATTCTGGGGGGGGCAAAGCATGCCACGATGAAGAAGGGGGCTGTGCGACGGGCAGCGGAAAACCCGTCGAACCGAGGTGTGCCAGCGCTGGCTCGACGCGCTCTGCGCTCGTCAGCGACTGCGAGGCGGCTGGCCCGAAAGGGAAAGTCAGGCGGAAGAGGAAATCGAGGGGAGTTTCTTCCCGCGAAGGGAAGGGGGGGCTAACGTCGTCCTCTGACACGGATGCCCCACCGGAGAAAGTGGTGGTAGTCTCCGATTCGGCCTCTGCCGCGGAGGAGATGCCGCCCCCTAAAGAGAGACCCGCTCGGGGGAAGGGCGCACCGTCACCGGCGCCGTCATCGGCGTCGATGTCTGTCGCCTCGCTGGACGGGCGGACGACAGAAGAGGAGGAGGGCGGTCTTCGGGACCCTGCCTTGGTCATAGGCAGGGCCATGAAGACCGTCAAGTCGTATGCGGCGACCAGTGCCAAAACCAAAGCTGCTGGCCGCAGGCTGCGGGAAGTCGTCTCGCGAGTCTCGAAGGTTCTGCCTTCGGTTGCTTCCGCCAATGACCAGGTGGTGCAGCTGATGGCGGAGAATTTGAGGCTCCGAGCACAGCTACAGGCGCGGCAGCGGCCCGATGGCAAGGTTGCTGCTACCAAGCGGGTAGCCGCGACGAGGTCGTCGCCCGCGTTGCCGCGTGCCGCTGGGTCGCGGACTCCTCCGGCATCTGTGCCGGCGGTGTCGCCGCTGGTCTCCGGGGTCCCTCGGGGTCCCTGTCCCTCAGCGGCGGCTGGCGACCCGTGGCCCGTGCTGCCACCATCGCGCGCGGTACAGCGGCGTTCGCGTCTCCCGTCGCCGCGGTCTAGGGAGGCGACGGCCGTCGAGCGGCAGCAGGGATCCGCGGGGCCACGGATCTTGGGCCTGCCGGAACCGAATTGCTACAGCCTGGACGAGATTATCGATCGCACCGTCCAGGCTGTAATGGAAAGGCTGGGTGGCGGGCTGGCGGCTCTCGAAGCGAAACGTATTGTCGCTGGTGACGCTGAACGGCCTGCGTCTACACATGCCGCGGTGTCGGGTGCTGCAGTGACCCGCTCCACCCCCGTACAGGCTCCAGCTACTAGGGCGGGCCCGGGGCGAGATAGAGCCAAGCGGGGGGGCGGCGCTAACGCGAAGTGCACATCGCAAGCGCCTCAACCCCGTCCGCTGCCCCCGCCCCCGTCTAACATGGACGAGGGGTGGAATGTGGTGGCCCGGCGGGGTGCCAAGAGGGCCGTACCGACAGCTCCCCAAGTGGGTGGAGCACCGGCCACTGCGGCGTCTCAGGCTGCTCCCCAACAGGGTCGAGCGCCTGTGGCCGCCAAGAAAAAGAAGACGAAGAAGAAGTCGACGCGCGCGCCGCGGTCGGCGGCAGTGGTCTTAACGCTGCTGCCGGCCGCCGAGGCCAAGGGCGTGTCATACGGAGATGTAGTCTCCCGGGCGTGCGCGGCTATTGATCTGGACGAGATCGGGGCGGGGGAGGGCCTCCGCTGTAGGCTGACGGCCAATGGGGCCAAGCTACTAGAGTGTCCCGGTGCCGATAGTTCCGGCATCGCGGAGCGTCTGGCGGCGAAGCTCCGTACGGTTCTGCCTGAGGAGGAGGTTCGAGTGCACAGGCCGGTCAAAATGGCTGAATTGAGAGTGACCGGCCTGGATGACTGCACCACTAAGGATGAGGTGGCGGCGGCTATTGCCGCCCGGGGCAACTGCGCCCTGGAGAATATAACCGTAGGCGAGCTGCGCCTCGGTTATACCGGGGCTGGCTCTGTTTGGGTGCGTTGCCCGGTAGAGGCGGCCACCTCCTTGGCTGCTCCTCCGCCCGGGAGACCGTCGGGGGAACCGGGCAGGTTGCGCGTGGGCTGGATAGCGGCCCGCGTGCGCCTTCTCGAACCACGCGCCTGGCGGTGCCTCAGATGCTTCAGCACTGGGCACTGCCTTGCTAAATGCGCGAGTGCCGTTGACCGCAGCGGATTGTGCTTTCGCTGTGGTCAGCCGGGACACAAGGCGGCCGTGTGCTCGGCTGCGCCGCACTGCTTATTATGTGCGGCGGCCGGGCGCAAGGCTGACCACCGGGCCGGGGCAAGGCCTGCCCTCCGGCCAGCAAGAATGCTGAACGAAATCGGCGCCGCCAAGCTAAGCGGCGTCAAAAGAAGCGGTTGGCCGGGGGAGCACCGGCCGGCACTTTGTCCCCCGCTGAGGCGTTCGCGCCCGATAGCGGGGGCAATGGAGTAG
Protein
MMANLQKTLPQEGTTLGGESLRASTSVGACCPTYSGGGKACHDEEGGCATGSGKPVEPRCASAGSTRSALVSDCEAAGPKGKVRRKRKSRGVSSREGKGGLTSSSDTDAPPEKVVVVSDSASAAEEMPPPKERPARGKGAPSPAPSSASMSVASLDGRTTEEEEGGLRDPALVIGRAMKTVKSYAATSAKTKAAGRRLREVVSRVSKVLPSVASANDQVVQLMAENLRLRAQLQARQRPDGKVAATKRVAATRSSPALPRAAGSRTPPASVPAVSPLVSGVPRGPCPSAAAGDPWPVLPPSRAVQRRSRLPSPRSREATAVERQQGSAGPRILGLPEPNCYSLDEIIDRTVQAVMERLGGGLAALEAKRIVAGDAERPASTHAAVSGAAVTRSTPVQAPATRAGPGRDRAKRGGGANAKCTSQAPQPRPLPPPPSNMDEGWNVVARRGAKRAVPTAPQVGGAPATAASQAAPQQGRAPVAAKKKKTKKKSTRAPRSAAVVLTLLPAAEAKGVSYGDVVSRACAAIDLDEIGAGEGLRCRLTANGAKLLECPGADSSGIAERLAAKLRTVLPEEEVRVHRPVKMAELRVTGLDDCTTKDEVAAAIAARGNCALENITVGELRLGYTGAGSVWVRCPVEAATSLAAPPPGRPSGEPGRLRVGWIAARVRLLEPRAWRCLRCFSTGHCLAKCASAVDRSGLCFRCGQPGHKAAVCSAAPHCLLCAAAGRKADHRAGARPALRPARMLNEIGAAKLSGVKRSGWPGEHRPALCPPLRRSRPIAGAME

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
783
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00143
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00007
outside
1  -  783
 
 

Population Genetic Test Statistics

Pi
215.124306
Theta
145.900289
Tajima's D
1.691791
CLR
197.538692
CSRT
0.829158542072896
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号