SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15701
Pre Gene Modal
BGIBMGA002305
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.766 Nuclear   Reliability : 1.963
 

Sequence

CDS
ATGGTCGAAAGTTGTAATCAAACATTGGAGAGATATCTGGCGAAAGTTGTGGAGAATAGGACTGTGACGCCGTTTTTCGCAAACTTTGGAAGAGAATTGAGACTGCCTGCGGATTTAGTTATCGGCACTCCTCCTGACGTTTCTCGTAGTGTGACAGAGTACGCGAATGATTTGCGCAGCAAGATAAATGAAGTGCATGAGCATAAAGGTCTACCAGGCGTGCCTAAAGTTGTACGTGTAGATCGATTGGCGAAATGTTACGGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAAGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCAACTCGCGGCGTTCGATGATGATGAAAAAGCAGAGCTGCTAGCCGATACACTGCAAACCCAGTGCACGCCCAGCACTCAATCCATGGACCCTGTTCATGTAGAATTAGTAGATAGTGAGGTGGAACGCAGAGCCTCCTTGCCACCCTCGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTACCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAAGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATTGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTTCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCTTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCAACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCTAGGAAGGTCAAGTACCTGGGCGTTACCCTGAATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGTAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGAAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCCGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAACCTAA
Protein
MVESCNQTLERYLAKVVENRTVTPFFANFGRELRLPADLVIGTPPDVSRSVTEYANDLRSKINEVHEHKGLPGVPKVVRVDRLAKCYGIAEVRDARWSDFLERLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGQLAAFDDDEKAELLADTLQTQCTPSTQSMDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCILPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNCLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSFPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLNASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPGNRTRRTRQRGRRAT

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    GALX01005359    JAB63107.1    GALX01005299    JAB63167.1    KQ973342    KXZ75569.1    GGMR01019198    MBY31817.1    ABLF02042518    ABLF02057746    ABLF02029306    ABLF02029314    ABLF02060138    GGMS01002955    MBY72158.1    RPOV01000134    RPJ78669.1    ABLF02033757    GGMS01000737    MBY69940.1    ABLF02008463    GGMS01006359    MBY75562.1    GGMR01000676    MBY13295.1    GBBI01004395    JAC14317.1    GFXV01007093    MBW18898.1    GGMR01003407    MBY16026.1    GGMR01018716    MBY31335.1    GGMS01017914    MBY87117.1    NEVH01006736    PNF36716.1    GEZM01038405    JAV81653.1    GEZM01053022    JAV74219.1    GFTR01008038    JAW08388.1    GBBI01001646    JAC17066.1    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02034467    S59870    AAB26437.2    NEVH01020940    PNF20481.1    GBBI01004571    JAC14141.1    ABLF02021177    ABLF02027367    ABLF02066338    NEVH01006721    PNF37225.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    NEVH01000269    PNF43694.1    GFDF01007661    JAV06423.1    ABLF02037660    NWSH01000032    PCG80497.1    NEVH01026386    PNF14434.1    GBYB01008290    JAG78057.1    ABLF02020655    ABLF02039168    ABLF02061060    NEVH01017542    PNF24034.1    NEVH01020071    PNF21969.1    NEVH01002704    PNF41489.1    NEVH01023962    PNF17612.1    NEVH01010546    PNF32261.1    NEVH01003017    PNF40781.1    NEVH01018383    PNF23463.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    GFTR01008262    JAW08164.1    NEVH01007443    PNF35684.1    AY060438    AAL25477.1    GBGD01000880    JAC88009.1    GBGD01000799    JAC88090.1    GGFJ01001857    MBW50998.1    GGMS01017365    MBY86568.1    ABLF02024246    NEVH01005938    PNF38077.1    NEVH01001355    PNF42855.1    GGFJ01001858    MBW50999.1    NEVH01022639    PNF18527.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    JXUM01241784    KQ635293    KXJ62492.1    GEZM01074951    JAV64378.1    NEVH01021205    PNF19912.1    PCG80496.1    GEZM01084969    JAV60363.1    NEVH01007838    PNF34986.1    LBMM01014395    KMQ85192.1    NEVH01014858    PNF27387.1    NEVH01000280    PNF43672.1    NEVH01002716    PNF41415.1    GFTR01008256    JAW08170.1    KQ973412    EFA12510.2    NEVH01019964    PNF22161.1    NEVH01016302    PNF25823.1    NEVH01023961    PNF17613.1    GBBI01001570    JAC17142.1    GGMS01002992    MBY72195.1    NEVH01012089    PNF30491.1    NEVH01007393    PNF35987.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
704
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.04170000000001
Exp number, first 60 AAs:
0.00134
Total prob of N-in:
0.06924
outside
1  -  704
 
 

Population Genetic Test Statistics

Pi
242.947545
Theta
21.96821
Tajima's D
3.899067
CLR
0.206613
CSRT
0.99870006499675
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号