SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15696
Annotation
PREDICTED:_uncharacterized_protein_LOC103311804_[Acyrthosiphon_pisum]
Location in the cell
Mitochondrial   Reliability : 1.311 Nuclear   Reliability : 1.147
 

Sequence

CDS
ATGGTCACAGTTGACGTACGCCCGGACGAGATCACACGTAATCCTACCTTCGAGTCTAGCACTGCAGCCTCCACTAATGCGTATGTGGGCTACAGTCGCTCGGTAGTTCTTTTGGGTACTTGTGTAGTTCGCGTTCGTCATCCTCGCAGTACTAATCAATCATTTCTTGTACGTGCGTTGATTGATAGTGGTGCTCAAGATTGTTTCATTACCAAGTCATGTTGTCAACGTATGGGCTTACCATTACGTCGCTGTCCATTAGCCGTAGTTGGTCTAGGTCAAAATGCTGTACATCACGTGACTGGAGTTACTTCTTGCACTGTACTTTCTCGTACTTCAGAAAATCCTCATTTCAACATTAATCCTATCGTAGTAAATACTATAACGAGTAAAATGCCTGCTACAAACTTACCTAGTAATCTTCGTGAATCTTTTAAACATCTGGTCCTCGCAGATGAGAATTTTGATAAACCATCAAATGTAGATTTACTACTCGGCGCAGAACTGTTCCATAGTATTTATGACGGTCAACGCGTTCAGCCCAGTCATGACCTACCGGTAGCTTTACACAGCGTGTTTGGTTGGGTCATCACCGGCAAACTTAATACAAACTATTTACCTCCGCCAACAATATCTTCTCTCTTAGCATCCACACGTTCTCTGGACGAGGGACTTAAGCGATTCTGGGAGATCGAAGAACCTCCAAATCAGGTTATTTTAAACCCTGAAGATATTAAATGTGAACAAATGTACTCAAATCTAACGTATCGTAATCCCGAGGGCAGATATGTGGTACCTATGCTTCTCAAAGAACCTATCAGTCAACTAGGCGATTCTTTCAACCAATCATTCTCTCGGCTCGTTAACCTAGAACGACGCCTTGATCGAAACTTAGAGTTGAAAAAAGAGTACACCGCCTTTATGTTGTTAGGGCATATGGAGCCTAGCGCTGACTCGAATAAAATCGGGCAGTATATAATTCCTCATCATTGTGTCATTCGCCCGGAAAGTACAACGACTAAACTTAGAGTTGTATTCGATGCTAGCGCCAAAACTACCAATGGCAAATCTCTTAACGATCTTGTATATACTGGTCCAAAACTTCAAAACGATATAGGAGATATACTTACAAAATTTCGGTTGCATGCTGTTGTTTTTACTGCCGACATCAGTAAGATGTATCGAAACATCGAACTTAGGCCAGAAGACCGAAAATGGCAGCATATACTTTGGCGCGATTCTCCTTCTGATCCTATAACTGAGTACGAGCTGAAAACGGTAACCTACGGGGTTACGAGTTCCCCTTATCTGGCAATACGTACTCTGCATCAATTAGCCTCTGACTACGAAAAAGAGTGGCCATTAGCTGCTGCTAGTCTTCGTCATGATACTTTCATGGATGACATCACTGTTGGTGCTACATCTATTGAAACTGCACTGAAACATAAAGAAGAGTTAATACAAATGTTAGCGCGTGCTAAGTTCGAATTACGTAAATGGAGTAGCAACTCACCTGAATTCCTTACCCAGATACCAACGGAACATTGTCAGGTTCCAAAACGTCCGTCTGGTGTAGTGGTAAGTGACATGGTCACTACACTAGGGGGTCGCGGGTTCGAATCCCGCCAAGGGAAGATATTTGTATGA
Protein
MVTVDVRPDEITRNPTFESSTAASTNAYVGYSRSVVLLGTCVVRVRHPRSTNQSFLVRALIDSGAQDCFITKSCCQRMGLPLRRCPLAVVGLGQNAVHHVTGVTSCTVLSRTSENPHFNINPIVVNTITSKMPATNLPSNLRESFKHLVLADENFDKPSNVDLLLGAELFHSIYDGQRVQPSHDLPVALHSVFGWVITGKLNTNYLPPPTISSLLASTRSLDEGLKRFWEIEEPPNQVILNPEDIKCEQMYSNLTYRNPEGRYVVPMLLKEPISQLGDSFNQSFSRLVNLERRLDRNLELKKEYTAFMLLGHMEPSADSNKIGQYIIPHHCVIRPESTTTKLRVVFDASAKTTNGKSLNDLVYTGPKLQNDIGDILTKFRLHAVVFTADISKMYRNIELRPEDRKWQHILWRDSPSDPITEYELKTVTYGVTSSPYLAIRTLHQLASDYEKEWPLAAASLRHDTFMDDITVGATSIETALKHKEELIQMLARAKFELRKWSSNSPEFLTQIPTEHCQVPKRPSGVVVSDMVTTLGGRGFESRQGKIFV

Summary

EMBL
ABLF02024986    GALX01004947    JAB63519.1    ABLF02026240    ABLF02055027    GGMR01018294    + More
MBY30913.1    ABLF02008319    ABLF02008320    ABLF02004035    ABLF02004036    ABLF02004037    ABLF02004038    ABLF02008018    ABLF02008020    ABLF02012635    ABLF02061171    GGMS01014133    MBY83336.1    GGMR01011131    MBY23750.1    ABLF02025193    ABLF02003339    ABLF02058001    GALX01002411    JAB66055.1    ABLF02041762    ABLF02002658    ABLF02034765    ABLF02042453    ABLF02028666    ABLF02066713    GGMR01003897    MBY16516.1    GFTR01008866    JAW07560.1    GGMR01002421    MBY15040.1    GGMR01005823    MBY18442.1    GGMR01006575    MBY19194.1    ABLF02015138    ABLF02012239    ABLF02012241    ABLF02017372    ABLF02042178    ABLF02066436    GGMR01017890    MBY30509.1    GGMR01009860    MBY22479.1    ABLF02008594    ABLF02054908    ABLF02005616    ABLF02059449    GGMR01016460    MBY29079.1    GGMS01012504    MBY81707.1    ABLF02041614    ABLF02030854    ABLF02067347    ABLF02036131    ABLF02041527    ABLF02064049    GGMR01010723    MBY23342.1    ABLF02028417    ABLF02042407    GGMR01019355    MBY31974.1    ABLF02006784    ABLF02038236    GBHO01006408    JAG37196.1    ABLF02041650    ABLF02005684    GDHC01008459    JAQ10170.1    GECZ01008071    JAS61698.1    LBMM01012238    KMQ86334.1    GBRD01007977    JAG57844.1    ABLF02021785    ABLF02008635    ABLF02023121    ABLF02065930    ABLF02065931    ABLF02034704    ABLF02034708    ABLF02034709    ABLF02044644    ABLF02055319    GGMS01012379    MBY81582.1    ABLF02008636    GGMS01014951    MBY84154.1    GGMR01013370    MBY25989.1    GGMR01003717    MBY16336.1    GEZM01085145    GEZM01085143    JAV60187.1    GGMR01014306    MBY26925.1    ABLF02008032    ABLF02035293    ABLF02060940    GBHO01038800    JAG04804.1    ABLF02018732    ABLF02018737    GGMR01002187    MBY14806.1    GBHO01007689    JAG35915.1    ABLF02009779    ABLF02067216    ABLF02008475    ABLF02041459    ABLF02066034    ABLF02003736    ABLF02008292    ABLF02008294    ABLF02046909    ABLF02052378    GGMR01002024    MBY14643.1    ABLF02004278    ABLF02004280    ABLF02065929    GGMR01010198    MBY22817.1    GEZM01078370    GEZM01078366    GEZM01078363    JAV62757.1    ABLF02035780    GBHO01037783    JAG05821.1    ABLF02041670    ABLF02039606    GBHO01038805    GBHO01038804    GBHO01038801    JAG04799.1    JAG04800.1    JAG04803.1    GBHO01037781    JAG05823.1    ABLF02036323    ABLF02066977    ABLF02014763    ABLF02016494    LBMM01005112    KMQ91804.1    GGMR01008932    GGMR01010920    MBY21551.1    MBY23539.1    ABLF02042081    ABLF02027576    ABLF02066434    ABLF02066438    ABLF02006304    ABLF02036268    GDHC01016272    JAQ02357.1    GGMR01009854    MBY22473.1    ABLF02067195    GBBI01004410    JAC14302.1    GEBQ01008638    JAT31339.1    GBBI01004408    JAC14304.1    GBHO01000059    JAG43545.1    ABLF02030698    ABLF02030705    ABLF02030709    GGMR01004029    MBY16648.1    GBHO01000060    JAG43544.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    GBHO01039691    GBHO01039690    JAG03913.1    JAG03914.1    GGMS01009443    MBY78646.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1   
Pfam
PF18701   DUF5641        + More
PF05380   Peptidase_A17
PF03564   DUF1759
PF05585   DUF1758
PF17921   Integrase_H2C2
PF00665   rve
PF00078   RVT_1
PF09337   zf-H2C2
Interpro
IPR001584   Integrase_cat-core        + More
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR005312   DUF1759       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR001969   Aspartic_peptidase_AS       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR017907   Znf_RING_CS       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR015416   Znf_H2C2_histone_UAS-bd       
IPR001995   Peptidase_A2_cat       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D
PDB
4OL8     E-value=0.0602544,     Score=86

Ontologies

Topology

Length:
548
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0460600000000001
Exp number, first 60 AAs:
0.03634
Total prob of N-in:
0.00373
outside
1  -  548
 
 

Population Genetic Test Statistics

Pi
281.927094
Theta
179.290165
Tajima's D
2.027106
CLR
0.00072
CSRT
0.88365581720914
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号