SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15670
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.333
 

Sequence

CDS
ATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGATACCGTCGAATCCATAAACATCTTCACTGATCACGTCTCGACGGCGATCATAAGATCCTCGAAACAAGTCGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGATCTTAGGGACCTCGTTAGAATCAGAAACGCGGCAATCCGGGCCTACGATCGATATCCCACGGATTCAAACCGGACTCGGATGCGTCGCTTACAGCGGGAGGTCAAATCCCGCTTAAGCGACGCCCGAAACGAAAACTGGGATAGTTATTTAGAAGAACTCGCGCCCACTCACCAAGCATACTGGCGACTAGCTAGGACCCTCAAGTCCGAAACTATAGCCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAATCACCGGCTTACGATGACGATAACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAACAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTCGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTTAAGGAGGCGATCGATAGCCTACAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAATTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATATTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAATAAAATTCTTATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGGCTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGTATATCAACGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCGGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATTAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCTCTCCCGACTAGGCGCGTCAACACCCCCGCCCCCGCCGTTCGCCCAATCACGATGTTCGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATCAAGACGGTACGCGACCGTGCCGCCTTCATCCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCATACACTTAAAATCCTTTCAAATCATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTTCAGTCGGCGTCCATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTCCCGATCCACTAACGGTGCTTTTAGGCAAAGAGCTGTCAATTCAGTCTTAA
Protein
MQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESINIFTDHVSTAIIRSSKQVDVEDCFHRIRLSPDLRDLVRIRNAAIRAYDRYPTDSNRTRMRRLQREVKSRLSDARNENWDSYLEELAPTHQAYWRLARTLKSETIATMPPLVRPSGQSPAYDDDNKAELLADALQEQCTTSTQHADPEHTEFVDREVERRASLPPSDALPPITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNTPAPAVRPITMFDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARIHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLGKELSIQS

Summary

EMBL
AB018558    BAA76304.1    U07847    AAA17752.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    GALX01005359    JAB63107.1    GGMR01019198    MBY31817.1    ABLF02029306    ABLF02029314    ABLF02060138    S59870    AAB26437.2    GGMS01006359    MBY75562.1    GBBI01004395    JAC14317.1    RPOV01000134    RPJ78669.1    GFTR01008038    JAW08388.1    ABLF02042518    ABLF02057746    GBBI01004571    JAC14141.1    GFXV01007093    MBW18898.1    NEVH01006736    PNF36716.1    ABLF02033757    GGMR01018716    MBY31335.1    GGMS01002955    MBY72158.1    NEVH01006721    PNF37225.1    GGMR01003407    MBY16026.1    GBBI01001646    JAC17066.1    GGMS01000737    MBY69940.1    NEVH01026386    PNF14434.1    GGMS01002992    MBY72195.1    GEZM01053022    JAV74219.1    ABLF02008463    GGFJ01002256    MBW51397.1    JRES01000644    KNC29657.1    GGMS01008766    MBY77969.1    GGFJ01002257    MBW51398.1    ABLF02024246    GGMR01012305    MBY24924.1    NEVH01020940    PNF20481.1    GGFJ01001842    MBW50983.1    GGFJ01001844    MBW50985.1    GGFJ01001843    MBW50984.1    GEZM01038405    JAV81653.1    ABLF02008153    ABLF02008462    ABLF02008464    GFTR01008271    JAW08155.1    GBYB01008290    JAG78057.1    LBMM01014395    KMQ85192.1    GFTR01008262    JAW08164.1    GFTR01008279    JAW08147.1    JXUM01155316    KQ572171    KXJ68070.1    GGMR01000676    MBY13295.1    GGFL01004957    MBW69135.1    KK119692    KFM76444.1    KQ973412    EFA12510.2    GGMS01004444    MBY73647.1    NEVH01000269    PNF43694.1    GGFL01005012    MBW69190.1    GFTR01008251    JAW08175.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    NEVH01003017    PNF40781.1    GGMR01000005    MBY12624.1    GFDF01007661    JAV06423.1    NEVH01018383    PNF23463.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01007443    PNF35684.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GGFJ01001858    MBW50999.1    KQ973363    EFA13335.2    NEVH01005938    PNF38077.1    ABLF02034467    GEZM01074951    JAV64378.1    NEVH01010546    PNF32261.1    NEVH01020071    PNF21969.1    NEVH01016302    PNF25823.1    NEVH01017542    PNF24034.1    NEVH01023962    PNF17612.1    GFTR01008256    JAW08170.1    NEVH01019964    PNF22161.1    GGMS01017914    MBY87117.1    NEVH01001355    PNF42855.1    GGFJ01001857    MBW50998.1    ABLF02040174    ABLF02040183    ABLF02055266    GGMR01014053    MBY26672.1    NEVH01022639    PNF18527.1    ABLF02021177    ABLF02027367    ABLF02066338    NEVH01007838    PNF34986.1    NEVH01000280    PNF43672.1    NEVH01014858    PNF27387.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.00216541,     Score=100

Ontologies

Topology

Length:
723
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.550189999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00900
outside
1  -  723
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号